Rmu_co8337263.1_g000001

Zinc-binding domain present in Lin-11, Isl-1, Mec-3.

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8337263.1
Physical Location & Seq
Forward (+)
1 .. 792
792 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8337263.1_g000001.1.cds

Sequence Viewer

Length: 329 bp
gcacaccgaaaattttgaaaccagaaaaaccttcgattgagaatgagaataacaaggcagtatcaaacatgtttgttggtaccaaagataaatgtgtgggatgtgaaaagacggtgtatcccattgagaaggtctcggtgaatgggacttcataccacaggaggtgcttcaaatgtacccatggaggttgcaccataagcccatctaactatattgcacatgaaggaaagctctactgcaaacaccaccacatccaactcttcaaggagaaagggaattacagccagcttgagaatgaacgtgaaaagcaatcagagactggtacttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

108

Amino Acids

12.26

Weight (kDa)

8.89

Isoelectric Point (pI)

40.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 79
AccB1I GGYRCC 1 cut(s) 79
AcsI RAATTY 1 cut(s) 11
AfaI GTAC 3 cut(s) 81, 177, 324
AflIII ACRYGT 1 cut(s) 68
AgsI TTSAA 3 cut(s) 18, 171, 264
AluBI AGCT 2 cut(s) 231, 288
AluI AGCT 2 cut(s) 231, 288
Alw26I GTCTC 2 cut(s) 138, 310
AlwNI CAGNNNCTG 1 cut(s) 319
ApoI RAATTY 1 cut(s) 11
Asp718I GGTACC 1 cut(s) 79
AsuHPI GGTGA 1 cut(s) 150
BanI GGYRCC 1 cut(s) 79
BccI CCATC 1 cut(s) 210
BciVI GTATCC 1 cut(s) 128
BcoDI GTCTC 2 cut(s) 138, 310
BfuI GTATCC 1 cut(s) 128
BmiI GGNNCC 1 cut(s) 81
BplI GAGNNNNNCTC 2 cut(s) 118, 150
BpuEI CTTGAG 1 cut(s) 310
BsaI GGTCTC 1 cut(s) 138
BsaJI CCNNGG 1 cut(s) 180
Bse1I ACTGG 1 cut(s) 324
BseDI CCNNGG 1 cut(s) 180
BseGI GGATG 2 cut(s) 106, 251
BseNI ACTGG 1 cut(s) 324
BshNI GGYRCC 1 cut(s) 79
BslFI GGGAC 1 cut(s) 159
BsmAI GTCTC 2 cut(s) 138, 310
BsmFI GGGAC 1 cut(s) 159
Bso31I GGTCTC 1 cut(s) 138
Bsp19I CCATGG 1 cut(s) 180
BspLI GGNNCC 1 cut(s) 81
BspT107I GGYRCC 1 cut(s) 79
BspTNI GGTCTC 1 cut(s) 138
BsrI ACTGG 1 cut(s) 324
BssECI CCNNGG 1 cut(s) 180
BssT1I CCWWGG 1 cut(s) 180
Bst4CI ACNGT 1 cut(s) 114
Bst6I CTCTTC 1 cut(s) 265
BstC8I GCNNGC 1 cut(s) 286
BstDEI CTNAG 1 cut(s) 326
BstDSI CCRYGG 1 cut(s) 180
BstF5I GGATG 2 cut(s) 106, 251
BstMAI GTCTC 2 cut(s) 138, 310
BstMWI GCNNNNNNNGC 1 cut(s) 197
BstNSI RCATGY 1 cut(s) 72
BsuI GTATCC 1 cut(s) 128
BtgI CCRYGG 1 cut(s) 180
BtsCI GGATG 2 cut(s) 106, 251
Cac8I GCNNGC 1 cut(s) 286
CaiI CAGNNNCTG 1 cut(s) 319
Csp6I GTAC 3 cut(s) 80, 176, 323
CviAII CATG 3 cut(s) 69, 181, 220
CviJI RGCY 4 cut(s) 200, 231, 284, 288
CviKI_1 RGCY 4 cut(s) 200, 231, 284, 288
CviQI GTAC 3 cut(s) 80, 176, 323
DdeI CTNAG 1 cut(s) 326
Eam1104I CTCTTC 1 cut(s) 265
EarI CTCTTC 1 cut(s) 265
Eco130I CCWWGG 1 cut(s) 180
Eco31I GGTCTC 1 cut(s) 138
EcoT14I CCWWGG 1 cut(s) 180
ErhI CCWWGG 1 cut(s) 180
FaeI CATG 3 cut(s) 72, 184, 223
FaiI YATR 6 cut(s) 70, 153, 182, 196, 212, 221
FaqI GGGAC 1 cut(s) 159
FatI CATG 3 cut(s) 68, 180, 219
FokI GGATG 2 cut(s) 113, 238
Hin1II CATG 3 cut(s) 72, 184, 223
HphI GGTGA 1 cut(s) 150
Hpy188I TCNGA 1 cut(s) 315
HpyAV CCTTC 3 cut(s) 41, 123, 217
HpyCH4III ACNGT 1 cut(s) 114
HpyCH4IV ACGT 1 cut(s) 300
HpyCH4V TGCA 3 cut(s) 191, 217, 239
HpyF10VI GCNNNNNNNGC 1 cut(s) 197
HpyF3I CTNAG 1 cut(s) 326
HpySE526I ACGT 1 cut(s) 300
Hsp92II CATG 3 cut(s) 72, 184, 223
KpnI GGTACC 1 cut(s) 83
LpnPI CCDG 4 cut(s) 35, 144, 298, 305
MaeII ACGT 1 cut(s) 300
MboII GAAGA 1 cut(s) 252
MluCI AATT 2 cut(s) 11, 276
MmeI TCCRAC 1 cut(s) 279
MnlI CCTC 2 cut(s) 155, 178
MwoI GCNNNNNNNGC 1 cut(s) 197
NcoI CCATGG 1 cut(s) 180
NlaIII CATG 3 cut(s) 72, 184, 223
NlaIV GGNNCC 1 cut(s) 81
NspI RCATGY 1 cut(s) 72
PciI ACATGT 1 cut(s) 68
PscI ACATGT 1 cut(s) 68
PspN4I GGNNCC 1 cut(s) 81
PstNI CAGNNNCTG 1 cut(s) 319
RsaI GTAC 3 cut(s) 81, 177, 324
RsaNI GTAC 3 cut(s) 80, 176, 323
SetI ASST 7 cut(s) 33, 134, 166, 189, 233, 290, 303
SmlI CTYRAG 1 cut(s) 289
SmoI CTYRAG 1 cut(s) 289
Sse9I AATT 2 cut(s) 11, 276
StyI CCWWGG 1 cut(s) 180
TaaI ACNGT 1 cut(s) 114
TaiI ACGT 1 cut(s) 303
TaqI TCGA 1 cut(s) 34
TasI AATT 2 cut(s) 11, 276
TspDTI ATGAA 3 cut(s) 140, 236, 311
XapI RAATTY 1 cut(s) 11
XceI RCATGY 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.