Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000056.1

Orthogroup ID

OG0002362

Physical Location & Seq

Genomic Coordinates Forward (+)

43364 .. 44140

Gene Structure 777 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000056.1_g000010.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 777 bp

atgctcgtccgagtgggattgcttagagaagttgagttcttgctttccacaatggaaagtaaaggagtttcgttggatagtcaagaaatttacagtgatttgattgaagggtatgttggtattggtgagctagatagggccatttcggtatatgatcgaattagggggcgtgtagtgccatcattgcagtgttgttgtgttctacttgatcaattggtgggcctgaggaagacccaattggcgtttcaagtttgtagtgatatggcagaaatgggttttgacttgagagatgtgaagaaggccacatttgagggtgtcattagactgctttgcagggatggaaagattcaggaggcaagaaattttgtcatgaaggctatggctttcaaactcaagccaagcaacttagttttaaatgaagttgcttatggctattgtgagaagaaggactctgatgatttgatgagcttctatgctgagattaagtgtgccccagaagttatggctgggaataggattatgcattctctttgtttagatagggccatttcggtatatgatcaaattagggggcgtgtagtgccatcattgcagtgttgttgtgttctacttgatcaattggtgggaatgaggaagaccgaattggcgtttcaagtttgtagtgatatggcagaaatgggttttgatttgagagatgtgaagaaggccacatttgagggtgtcattagactgctttgcagggatggaaagattcaagaggcaagaaatttgtcatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003824 GO:0004518 GO:0004519 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0006139 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009451 GO:0009987 GO:0016070 GO:0016787 GO:0016788 GO:0034641 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044424 GO:0044464 GO:0046483 GO:0048037 GO:0051536 GO:0051540 GO:0071704 GO:0090304 GO:0090305 GO:0097159 GO:1901360 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PPR PPR_1 PPR_2

Protein Analysis

258

Amino Acids

29.06

Weight (kDa)

6.03

Isoelectric Point (pI)

31.24

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002362)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G15280
fragaria_vesca	FvH4_6g47953 FvH4_6g48150 FvH4_6g48150 FvH4_6g48150 FvH4_6g48150 FvH4_6g48150 FvH4_6g48880 FvH4_6g48880
malus_domestica	MD09G1053400.v1.1
prunus_persica	Prupe.3G265200_v2.0.a1
rosa_chinensis	RchiOBHm_Chr2g0167491 RchiOBHm_Chr2g0167571 RchiOBHm_Chr2g0167581
rosa_laevigata	RLG00000021724 RLG00000021736
rosa_multiflora	Rmu_sc0000056.1_g000010 Rmu_sc0000056.1_g000011 Rmu_sc0001970.1_g000002
rosa_roxburghii	Rroxscaffold_2G00083370 Rroxscaffold_2G00083410 Rroxscaffold_2G00083440
rosa_rugosa	Rorug02G0530600
rosa_samantha	Rh2AG597900 Rh2AG598800 Rh2AG599200 Rh2AG599300 Rh2AG599400 Rh2BG609400 Rh2BG609800 Rh2BG609900 Rh2BG610000 Rh2CG580300 Rh2DG620700 Rh2DG621000 Rh2DG621100 Rh2DG621900 Rh2DG622000 Rh2DG622100 Rh2DG622600 Rh2DG622700
rosa_wichuraiana	Rw2G049750

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	3 cut(s)	87, 361, 766
AgsI	TTSAA	5 cut(s)	107, 248, 388, 653, 755
AjuI	GAANNNNNNNTTGG	8 cut(s)	99, 131, 221, 228, 253, 260, 626, 658
AluBI	AGCT	2 cut(s)	130, 468
AluI	AGCT	2 cut(s)	130, 468
AoxI	GGCC	5 cut(s)	138, 220, 300, 543, 705
ApoI	RAATTY	3 cut(s)	87, 361, 766
AspS9I	GGNCC	3 cut(s)	138, 220, 543
AsuHPI	GGTGA	1 cut(s)	137
AxyI	CCTNAGG	1 cut(s)	224
BaeGI	GKGCMC	1 cut(s)	493
BbsI	GAAGAC	2 cut(s)	236, 641
BccI	CCATC	4 cut(s)	187, 332, 592, 737
BclI	TGATCA	3 cut(s)	208, 559, 613
BfaI	CTAG	1 cut(s)	131
BmgT120I	GGNCC	3 cut(s)	138, 220, 543
BpiI	GAAGAC	2 cut(s)	236, 641
BpuEI	CTTGAG	2 cut(s)	304, 377
Bse21I	CCTNAGG	1 cut(s)	224
Bse3DI	GCAATG	2 cut(s)	182, 587
BseGI	GGATG	2 cut(s)	343, 748
BseMI	GCAATG	2 cut(s)	182, 587
BseMII	CTCAG	2 cut(s)	215, 468
BseSI	GKGCMC	1 cut(s)	493
BseYI	CCCAGC	1 cut(s)	506
BshFI	GGCC	5 cut(s)	140, 222, 302, 545, 707
BsmI	GAATGC	1 cut(s)	523
BsnI	GGCC	5 cut(s)	140, 222, 302, 545, 707
Bsp1286I	GDGCHC	1 cut(s)	493
Bsp143I	GATC	4 cut(s)	154, 208, 559, 613
BspANI	GGCC	5 cut(s)	140, 222, 302, 545, 707
BspCNI	CTCAG	2 cut(s)	216, 469
BspHI	TCATGA	2 cut(s)	369, 773
BsrDI	GCAATG	2 cut(s)	182, 587
BssMI	GATC	4 cut(s)	154, 208, 559, 613
Bst4CI	ACNGT	1 cut(s)	95
BstDEI	CTNAG	4 cut(s)	23, 224, 406, 477
BstF5I	GGATG	2 cut(s)	343, 748
BstKTI	GATC	4 cut(s)	157, 211, 562, 616
BstMBI	GATC	4 cut(s)	154, 208, 559, 613
BstMWI	GCNNNNNNNGC	4 cut(s)	175, 184, 580, 589
BstSLI	GKGCMC	1 cut(s)	493
BstV2I	GAAGAC	2 cut(s)	236, 641
Bsu36I	CCTNAGG	1 cut(s)	224
BsuRI	GGCC	5 cut(s)	140, 222, 302, 545, 707
BtsCI	GGATG	2 cut(s)	343, 748
BtsI	GCAGTG	2 cut(s)	194, 599
BtsIMutI	CAGTG	3 cut(s)	100, 194, 599
CciI	TCATGA	2 cut(s)	369, 773
Cfr13I	GGNCC	3 cut(s)	138, 220, 543
CviAII	CATG	2 cut(s)	370, 774
DdeI	CTNAG	4 cut(s)	23, 224, 406, 477
DpnI	GATC	4 cut(s)	156, 210, 561, 615
DpnII	GATC	4 cut(s)	154, 208, 559, 613
DraI	TTTAAA	1 cut(s)	414
Eco81I	CCTNAGG	1 cut(s)	224
EcoT22I	ATGCAT	1 cut(s)	525
FaeI	CATG	2 cut(s)	373, 777
FatI	CATG	2 cut(s)	369, 773
FbaI	TGATCA	3 cut(s)	208, 559, 613
FokI	GGATG	2 cut(s)	350, 755
FspBI	CTAG	1 cut(s)	131
GsaI	CCCAGC	1 cut(s)	510
HaeIII	GGCC	5 cut(s)	140, 222, 302, 545, 707
Hin1II	CATG	2 cut(s)	373, 777
HinfI	GANTC	3 cut(s)	346, 449, 751
HphI	GGTGA	1 cut(s)	137
Hpy188I	TCNGA	2 cut(s)	11, 454
Hpy188III	TCNNGA	5 cut(s)	83, 350, 370, 755, 774
HpyAV	CCTTC	5 cut(s)	101, 292, 367, 439, 697
HpyCH4III	ACNGT	1 cut(s)	95
HpyCH4V	TGCA	5 cut(s)	187, 333, 523, 592, 738
HpyF10VI	GCNNNNNNNGC	4 cut(s)	175, 184, 580, 589
HpyF3I	CTNAG	4 cut(s)	23, 224, 406, 477
Hsp92II	CATG	2 cut(s)	373, 777
Ksp22I	TGATCA	3 cut(s)	208, 559, 613
Kzo9I	GATC	4 cut(s)	154, 208, 559, 613
LpnPI	CCDG	6 cut(s)	236, 319, 335, 492, 507, 724
MaeI	CTAG	1 cut(s)	131
MalI	GATC	4 cut(s)	156, 210, 561, 615
MboI	GATC	4 cut(s)	154, 208, 559, 613
MboII	GAAGA	5 cut(s)	241, 307, 454, 646, 712
MfeI	CAATTG	3 cut(s)	212, 236, 617
MhlI	GDGCHC	1 cut(s)	493
MluCI	AATT	9 cut(s)	87, 159, 212, 236, 361, 564, 617, 641, 766
MlyI	GAGTC	1 cut(s)	443
MmeI	TCCRAC	1 cut(s)	54
MnlI	CCTC	6 cut(s)	219, 304, 346, 624, 709, 751
Mph1103I	ATGCAT	1 cut(s)	525
MseI	TTAA	2 cut(s)	413, 483
MslI	CAYNNNNRTG	2 cut(s)	187, 592
MunI	CAATTG	3 cut(s)	212, 236, 617
Mva1269I	GAATGC	1 cut(s)	523
MwoI	GCNNNNNNNGC	4 cut(s)	175, 184, 580, 589
NdeII	GATC	4 cut(s)	154, 208, 559, 613
NlaIII	CATG	2 cut(s)	373, 777
NsiI	ATGCAT	1 cut(s)	525
PagI	TCATGA	2 cut(s)	369, 773
PctI	GAATGC	1 cut(s)	523
PfeI	GAWTC	2 cut(s)	346, 751
PleI	GAGTC	1 cut(s)	443
PpsI	GAGTC	1 cut(s)	443
PspFI	CCCAGC	1 cut(s)	506
PspPI	GGNCC	3 cut(s)	138, 220, 543
RseI	CAYNNNNRTG	2 cut(s)	187, 592
SaqAI	TTAA	2 cut(s)	413, 483
Sau3AI	GATC	4 cut(s)	154, 208, 559, 613
Sau96I	GGNCC	3 cut(s)	138, 220, 543
SchI	GAGTC	1 cut(s)	443
SduI	GDGCHC	1 cut(s)	493
SetI	ASST	2 cut(s)	132, 470
SmiMI	CAYNNNNRTG	2 cut(s)	187, 592
SmlI	CTYRAG	2 cut(s)	283, 392
SmoI	CTYRAG	2 cut(s)	283, 392
Sse9I	AATT	9 cut(s)	87, 159, 212, 236, 361, 564, 617, 641, 766
SspMI	CTAG	1 cut(s)	131
TaaI	ACNGT	1 cut(s)	95
TaqI	TCGA	1 cut(s)	157
TaqII	GACCGA	1 cut(s)	653
TasI	AATT	9 cut(s)	87, 159, 212, 236, 361, 564, 617, 641, 766
TfiI	GAWTC	2 cut(s)	346, 751
Tru1I	TTAA	2 cut(s)	413, 483
Tru9I	TTAA	2 cut(s)	413, 483
TscAI	CASTG	3 cut(s)	100, 194, 599
TspDTI	ATGAA	2 cut(s)	386, 432
TspRI	CASTG	3 cut(s)	100, 194, 599
XapI	RAATTY	3 cut(s)	87, 361, 766
XspI	CTAG	1 cut(s)	131
Zsp2I	ATGCAT	1 cut(s)	525

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.