Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000494.1

Orthogroup ID

OG0003279

Physical Location & Seq

Genomic Coordinates Reverse (-)

7922 .. 8506

Gene Structure 585 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000494.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 585 bp

atggtaatggctcaaaaaaggaaattgagtaaggttggattgtataggaggttggggttgatgagtgctcaggtgttggacttgcagaatatggttgtgaagagggaagaggggagaagagagagggagtgtaggagagagaaaggtgaggctgagagagaggaaaggaggaaagaagttgagtttaggagagagaagaggaggaatgagcaggaggacttgttagaagatggagaattggagttgcaagagagagaggccatgtggacaagaagggagtttgagaaacggttgaggttacagggggagtttgatgaggagcgtcagaggaggatgaggatggaggagaggagggaggaggaggagttggagtggcgggagaggatggtaggtttgcaaattcagcatgagaagcaaatgatgcaaatgcatgctgaggcatgccagaaccaaatgcagattcttggggtcatggctaggtttgtttgtcaattttttgggtcaatgagtgatggccttgggggtggtttagggactgccaccccaaattttgcagaatttgcagcatcctggcggactgggtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

194

Amino Acids

23.42

Weight (kDa)

6.81

Isoelectric Point (pI)

75.89

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003279)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g06071
malus_domestica	MD09G1261100.v1.1
prunus_persica	Prupe.3G158400_v2.0.a1
pyrus_communis	pycom09g17540
rosa_chinensis	RchiOBHm_Chr1g0333501 RchiOBHm_Chr1g0334211 RchiOBHm_Chr7g0221661
rosa_laevigata	RLG00000002147 RLG00000029549 RLG00000029550 RLG00000029599 RLG00000029600 RLG00000029601
rosa_multiflora	Rmu_sc0000494.1_g000002 Rmu_sc0000494.1_g000004 Rmu_sc0000494.1_g000017 Rmu_sc0002955.1_g000015 Rmu_sc0003435.1_g000020 Rmu_sc0005016.1_g000034 Rmu_sc0012130.1_g000001 Rmu_sc0028037.1_g000004
rosa_roxburghii	Rroxscaffold_2G00088180 Rroxscaffold_3G00238140 Rroxscaffold_4G00317400
rosa_rugosa	Rorug01G0109400 Rorug01G0109500 Rorug01G0110100 Rorug01G0110200 Rorug01G0110300 Rorug07G0202800
rosa_samantha	Rh1BG101600 Rh1CG126900 Rh1CG129800 Rh7AG343300 Rh7BG333400
rosa_wichuraiana	Rw0G003360 Rw7G029120

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	376, 574
AcsI	RAATTY	3 cut(s)	399, 547, 557
AjnI	CCWGG	1 cut(s)	569
AjuI	GAANNNNNNNTTGG	2 cut(s)	444, 476
Alw21I	GWGCWC	1 cut(s)	70
AoxI	GGCC	2 cut(s)	258, 514
ApeKI	GCWGC	1 cut(s)	563
ApoI	RAATTY	3 cut(s)	399, 547, 557
AsuHPI	GGTGA	1 cut(s)	158
Bbv12I	GWGCWC	1 cut(s)	70
BbvCI	CCTCAGC	1 cut(s)	435
BbvI	GCAGC	1 cut(s)	575
BccI	CCATC	4 cut(s)	224, 334, 379, 506
BciT130I	CCWGG	1 cut(s)	571
BfaI	CTAG	1 cut(s)	477
BisI	GCNGC	1 cut(s)	564
BlsI	GCNGC	1 cut(s)	565
Bme1390I	CCNGG	1 cut(s)	571
BmrFI	CCNGG	1 cut(s)	571
BmsI	GCATC	2 cut(s)	411, 575
Bpu10I	CCTNAGC	2 cut(s)	69, 435
BsaJI	CCNNGG	1 cut(s)	517
BsaXI	ACNNNNNCTCC	6 cut(s)	206, 236, 350, 356, 380, 386
Bse1I	ACTGG	1 cut(s)	583
BseBI	CCWGG	1 cut(s)	571
BseDI	CCNNGG	1 cut(s)	517
BseGI	GGATG	4 cut(s)	339, 345, 390, 566
BseMII	CTCAG	3 cut(s)	83, 144, 426
BseNI	ACTGG	1 cut(s)	583
BseRI	GAGGAG	8 cut(s)	214, 332, 343, 359, 364, 371, 374, 377
BseXI	GCAGC	1 cut(s)	575
BshFI	GGCC	2 cut(s)	260, 516
BsiHKAI	GWGCWC	1 cut(s)	70
BslFI	GGGAC	1 cut(s)	547
BsmFI	GGGAC	1 cut(s)	547
BsnI	GGCC	2 cut(s)	260, 516
Bsp1286I	GDGCHC	1 cut(s)	70
BspACI	CCGC	2 cut(s)	376, 574
BspANI	GGCC	2 cut(s)	260, 516
BspCNI	CTCAG	3 cut(s)	82, 145, 427
BsrI	ACTGG	1 cut(s)	583
BssECI	CCNNGG	1 cut(s)	517
BssT1I	CCWWGG	1 cut(s)	517
Bst2UI	CCWGG	1 cut(s)	571
Bst4CI	ACNGT	1 cut(s)	291
Bst6I	CTCTTC	4 cut(s)	95, 102, 112, 191
BstAPI	GCANNNNNTGC	2 cut(s)	421, 560
BstC8I	GCNNGC	2 cut(s)	432, 442
BstDEI	CTNAG	3 cut(s)	69, 153, 435
BstF5I	GGATG	4 cut(s)	339, 345, 390, 566
BstMWI	GCNNNNNNNGC	4 cut(s)	403, 412, 421, 560
BstNI	CCWGG	1 cut(s)	571
BstNSI	RCATGY	2 cut(s)	434, 444
BstSCI	CCNGG	1 cut(s)	569
BstV1I	GCAGC	1 cut(s)	575
BsuRI	GGCC	2 cut(s)	260, 516
BtsCI	GGATG	4 cut(s)	339, 345, 390, 566
Cac8I	GCNNGC	2 cut(s)	432, 442
CseI	GACGC	1 cut(s)	311
CviAII	CATG	5 cut(s)	262, 407, 431, 441, 472
CviJI	RGCY	5 cut(s)	11, 152, 260, 476, 516
CviKI_1	RGCY	5 cut(s)	11, 152, 260, 476, 516
DdeI	CTNAG	3 cut(s)	69, 153, 435
Eam1104I	CTCTTC	4 cut(s)	95, 102, 112, 191
EarI	CTCTTC	4 cut(s)	95, 102, 112, 191
Eco130I	CCWWGG	1 cut(s)	517
EcoRII	CCWGG	1 cut(s)	569
EcoT14I	CCWWGG	1 cut(s)	517
EcoT22I	ATGCAT	1 cut(s)	432
ErhI	CCWWGG	1 cut(s)	517
FaeI	CATG	5 cut(s)	265, 410, 434, 444, 475
FaiI	YATR	7 cut(s)	45, 92, 263, 408, 432, 442, 473
FaqI	GGGAC	1 cut(s)	547
FatI	CATG	5 cut(s)	261, 406, 430, 440, 471
FauI	CCCGC	1 cut(s)	369
Fnu4HI	GCNGC	1 cut(s)	564
FokI	GGATG	4 cut(s)	346, 352, 397, 553
Fsp4HI	GCNGC	1 cut(s)	564
FspBI	CTAG	1 cut(s)	477
GluI	GCNGC	1 cut(s)	564
HaeIII	GGCC	2 cut(s)	260, 516
HgaI	GACGC	1 cut(s)	311
Hin1II	CATG	5 cut(s)	265, 410, 434, 444, 475
HinfI	GANTC	1 cut(s)	460
HphI	GGTGA	1 cut(s)	158
Hpy166II	GTNNAC	1 cut(s)	267
Hpy188I	TCNGA	1 cut(s)	327
Hpy8I	GTNNAC	1 cut(s)	267
HpyAV	CCTTC	1 cut(s)	267
HpyCH4III	ACNGT	1 cut(s)	291
HpyCH4V	TGCA	8 cut(s)	85, 247, 397, 424, 430, 457, 554, 563
HpyF10VI	GCNNNNNNNGC	4 cut(s)	403, 412, 421, 560
HpyF3I	CTNAG	3 cut(s)	69, 153, 435
Hsp92II	CATG	5 cut(s)	265, 410, 434, 444, 475
LmnI	GCTCC	1 cut(s)	319
LpnPI	CCDG	6 cut(s)	56, 197, 287, 458, 556, 564
Lsp1109I	GCAGC	1 cut(s)	575
LweI	GCATC	2 cut(s)	411, 575
MaeI	CTAG	1 cut(s)	477
MaeIII	GTNAC	1 cut(s)	297
MboII	GAAGA	5 cut(s)	112, 119, 129, 208, 239
MhlI	GDGCHC	1 cut(s)	70
MluCI	AATT	6 cut(s)	23, 236, 399, 491, 547, 557
MmeI	TCCRAC	3 cut(s)	16, 57, 348
Mph1103I	ATGCAT	1 cut(s)	432
MspR9I	CCNGG	1 cut(s)	571
MvaI	CCWGG	1 cut(s)	571
MwoI	GCNNNNNNNGC	4 cut(s)	403, 412, 421, 560
NlaIII	CATG	5 cut(s)	265, 410, 434, 444, 475
NsiI	ATGCAT	1 cut(s)	432
NspI	RCATGY	2 cut(s)	434, 444
PaeI	GCATGC	2 cut(s)	434, 444
PfeI	GAWTC	1 cut(s)	460
PkrI	GCNGC	1 cut(s)	565
Psp6I	CCWGG	1 cut(s)	569
PspGI	CCWGG	1 cut(s)	569
SatI	GCNGC	1 cut(s)	564
ScrFI	CCNGG	1 cut(s)	571
SduI	GDGCHC	1 cut(s)	70
SetI	ASST	7 cut(s)	36, 53, 75, 148, 299, 394, 482
SfaNI	GCATC	2 cut(s)	411, 575
SphI	GCATGC	2 cut(s)	434, 444
Sse9I	AATT	6 cut(s)	23, 236, 399, 491, 547, 557
SsiI	CCGC	2 cut(s)	376, 574
SspMI	CTAG	1 cut(s)	477
StyD4I	CCNGG	1 cut(s)	569
StyI	CCWWGG	1 cut(s)	517
TaaI	ACNGT	1 cut(s)	291
TasI	AATT	6 cut(s)	23, 236, 399, 491, 547, 557
TfiI	GAWTC	1 cut(s)	460
TseI	GCWGC	1 cut(s)	563
XapI	RAATTY	3 cut(s)	399, 547, 557
XceI	RCATGY	2 cut(s)	434, 444
XspI	CTAG	1 cut(s)	477
Zsp2I	ATGCAT	1 cut(s)	432

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.