Rmu_sc0000494.1_g000017

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000494.1
OG0003279
Physical Location & Seq
Reverse (-)
86977 .. 88135
1159 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000494.1_g000017.1.cds

Sequence Viewer

Length: 759 bp
atgtctcgagtgcagccattagagcgctacatgcctacatacatatctaaagccaatgtagatgaaaaaatcggagctgtagtttcaaaacccaatcggagctacgaccttgtctctgagtcttgtccacaatgttcaaactttctgaaaaaagaagaacatttggaagaagaagaagatggtactggtggtgatgacgataatcgtggcgaggaattgggtaaaactgaaattggtgagtttgggggtgaaagggaaattggggacatgggaatggctgaattgagtaaggttggattgcataggaggttggggctgatgagtgctcagatgttggacttgcagaatatggttgtgaagagggaagaggggaggagagagagggagtgtaggagagagaaaggtgaggctgagagagaggaaaggaggaaagaaggggagtttgatgaggagcatcagaggaggatgaggatggaggagaggagggaggaggagttggagtggcgggagaggatggtaggtttgcaaattcagcatgagaagcaaatgatgcaaatgcatgctgaggcatgccagaaccaaatgcagattcttggggtcatggctaggtttgtttgtcaattttttgggtcaatgagtgatggccttggaggtggtttagggactctgccaccccaaattttgcagaatttgcagcatcctggcggactgggtgaaaatgggaagccggattccaattcgccttctgagttcctctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

252

Amino Acids

28.88

Weight (kDa)

5.02

Isoelectric Point (pI)

70.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 505, 705
AcsI RAATTY 3 cut(s) 528, 678, 688
AfaI GTAC 1 cut(s) 184
AfeI AGCGCT 1 cut(s) 26
AgsI TTSAA 2 cut(s) 87, 138
AjnI CCWGG 1 cut(s) 700
AjuI GAANNNNNNNTTGG 4 cut(s) 243, 275, 573, 605
AluBI AGCT 2 cut(s) 77, 102
AluI AGCT 2 cut(s) 77, 102
Alw21I GWGCWC 1 cut(s) 328
Alw26I GTCTC 2 cut(s) 9, 118
Ama87I CYCGRG 1 cut(s) 6
Aor51HI AGCGCT 1 cut(s) 26
AoxI GGCC 1 cut(s) 643
ApeKI GCWGC 2 cut(s) 13, 694
ApoI RAATTY 3 cut(s) 528, 678, 688
AspLEI GCGC 1 cut(s) 27
AsuHPI GGTGA 5 cut(s) 203, 248, 260, 416, 725
AvaI CYCGRG 1 cut(s) 6
Bbv12I GWGCWC 1 cut(s) 328
BbvCI CCTCAGC 1 cut(s) 564
BbvI GCAGC 2 cut(s) 25, 706
BccI CCATC 4 cut(s) 173, 466, 508, 635
BciT130I CCWGG 1 cut(s) 702
BcoDI GTCTC 2 cut(s) 9, 118
BfaI CTAG 2 cut(s) 606, 757
BfmI CTRYAG 1 cut(s) 78
BfoI RGCGCY 1 cut(s) 28
BisI GCNGC 2 cut(s) 14, 695
BlsI GCNGC 2 cut(s) 15, 696
Bme1390I CCNGG 1 cut(s) 702
BmeT110I CYCGRG 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 702
BmrI ACTGGG 1 cut(s) 719
BmsI GCATC 3 cut(s) 463, 540, 706
BmuI ACTGGG 1 cut(s) 719
Bpu10I CCTNAGC 1 cut(s) 564
BsaJI CCNNGG 1 cut(s) 646
BsaXI ACNNNNNCTCC 6 cut(s) 66, 96, 479, 485, 509, 515
Bse1I ACTGG 2 cut(s) 190, 714
BseBI CCWGG 1 cut(s) 702
BseDI CCNNGG 1 cut(s) 646
BseGI GGATG 4 cut(s) 471, 477, 519, 697
BseMII CTCAG 5 cut(s) 108, 341, 402, 555, 738
BseNI ACTGG 2 cut(s) 190, 714
BseRI GAGGAG 7 cut(s) 388, 464, 475, 491, 496, 503, 506
BseXI GCAGC 2 cut(s) 25, 706
BsgI GTGCAG 1 cut(s) 32
BshFI GGCC 1 cut(s) 645
BsiHKAI GWGCWC 1 cut(s) 328
BsiHKCI CYCGRG 1 cut(s) 6
BsiSI CCGG 1 cut(s) 728
BslFI GGGAC 2 cut(s) 278, 676
BsmAI GTCTC 2 cut(s) 9, 118
BsmFI GGGAC 2 cut(s) 278, 676
BsnI GGCC 1 cut(s) 645
BsoBI CYCGRG 1 cut(s) 6
Bsp1286I GDGCHC 1 cut(s) 328
BspACI CCGC 2 cut(s) 505, 705
BspANI GGCC 1 cut(s) 645
BspCNI CTCAG 5 cut(s) 109, 340, 403, 556, 739
BsrI ACTGG 2 cut(s) 190, 714
BssECI CCNNGG 1 cut(s) 646
BssT1I CCWWGG 1 cut(s) 646
Bst2UI CCWGG 1 cut(s) 702
Bst6I CTCTTC 2 cut(s) 353, 360
BstAPI GCANNNNNTGC 2 cut(s) 550, 691
BstC8I GCNNGC 2 cut(s) 561, 571
BstDEI CTNAG 5 cut(s) 117, 327, 411, 564, 747
BstF5I GGATG 4 cut(s) 471, 477, 519, 697
BstH2I RGCGCY 1 cut(s) 28
BstHHI GCGC 1 cut(s) 27
BstMAI GTCTC 2 cut(s) 9, 118
BstMWI GCNNNNNNNGC 6 cut(s) 22, 31, 532, 541, 550, 691
BstNI CCWGG 1 cut(s) 702
BstNSI RCATGY 3 cut(s) 34, 563, 573
BstSCI CCNGG 1 cut(s) 700
BstSFI CTRYAG 1 cut(s) 78
BstV1I GCAGC 2 cut(s) 25, 706
BsuRI GGCC 1 cut(s) 645
BtsCI GGATG 4 cut(s) 471, 477, 519, 697
Cac8I GCNNGC 2 cut(s) 561, 571
CfoI GCGC 1 cut(s) 27
Csp6I GTAC 1 cut(s) 183
CviAII CATG 6 cut(s) 31, 268, 536, 560, 570, 601
CviQI GTAC 1 cut(s) 183
DdeI CTNAG 5 cut(s) 117, 327, 411, 564, 747
Eam1104I CTCTTC 2 cut(s) 353, 360
EarI CTCTTC 2 cut(s) 353, 360
EciI GGCGGA 1 cut(s) 720
Eco130I CCWWGG 1 cut(s) 646
Eco47III AGCGCT 1 cut(s) 26
Eco88I CYCGRG 1 cut(s) 6
EcoRII CCWGG 1 cut(s) 700
EcoT14I CCWWGG 1 cut(s) 646
EcoT22I ATGCAT 1 cut(s) 561
ErhI CCWWGG 1 cut(s) 646
FaeI CATG 6 cut(s) 34, 271, 539, 563, 573, 604
FaqI GGGAC 2 cut(s) 278, 676
FatI CATG 6 cut(s) 30, 267, 535, 559, 569, 600
FauI CCCGC 1 cut(s) 498
Fnu4HI GCNGC 2 cut(s) 14, 695
FokI GGATG 4 cut(s) 478, 484, 526, 684
Fsp4HI GCNGC 2 cut(s) 14, 695
FspBI CTAG 2 cut(s) 606, 757
GlaI GCGC 1 cut(s) 26
GluI GCNGC 2 cut(s) 14, 695
HaeII RGCGCY 1 cut(s) 28
HaeIII GGCC 1 cut(s) 645
HapII CCGG 1 cut(s) 728
HhaI GCGC 1 cut(s) 27
Hin1II CATG 6 cut(s) 34, 271, 539, 563, 573, 604
Hin6I GCGC 1 cut(s) 25
HinP1I GCGC 1 cut(s) 25
HinfI GANTC 4 cut(s) 119, 589, 664, 731
HpaII CCGG 1 cut(s) 728
HphI GGTGA 5 cut(s) 203, 248, 260, 416, 725
Hpy166II GTNNAC 1 cut(s) 128
Hpy188I TCNGA 7 cut(s) 74, 99, 118, 147, 330, 459, 748
Hpy188III TCNNGA 1 cut(s) 6
Hpy8I GTNNAC 1 cut(s) 128
HpyAV CCTTC 2 cut(s) 428, 753
HpyCH4V TGCA 9 cut(s) 13, 301, 343, 526, 553, 559, 586, 685, 694
HpyF10VI GCNNNNNNNGC 6 cut(s) 22, 31, 532, 541, 550, 691
HpyF3I CTNAG 5 cut(s) 117, 327, 411, 564, 747
Hsp92II CATG 6 cut(s) 34, 271, 539, 563, 573, 604
HspAI GCGC 1 cut(s) 25
LmnI GCTCC 3 cut(s) 74, 99, 451
LpnPI CCDG 6 cut(s) 171, 587, 687, 695, 714, 741
Lsp1109I GCAGC 2 cut(s) 25, 706
LweI GCATC 3 cut(s) 463, 540, 706
MaeI CTAG 2 cut(s) 606, 757
MboII GAAGA 7 cut(s) 167, 179, 182, 185, 188, 370, 377
MhlI GDGCHC 1 cut(s) 328
MluCI AATT 9 cut(s) 215, 231, 258, 281, 528, 620, 678, 688, 736
MlyI GAGTC 2 cut(s) 128, 658
MmeI TCCRAC 3 cut(s) 274, 315, 477
Mph1103I ATGCAT 1 cut(s) 561
MslI CAYNNNNRTG 1 cut(s) 272
MspI CCGG 1 cut(s) 728
MspR9I CCNGG 1 cut(s) 702
MvaI CCWGG 1 cut(s) 702
MwoI GCNNNNNNNGC 6 cut(s) 22, 31, 532, 541, 550, 691
NlaIII CATG 6 cut(s) 34, 271, 539, 563, 573, 604
NsiI ATGCAT 1 cut(s) 561
NspI RCATGY 3 cut(s) 34, 563, 573
PaeI GCATGC 2 cut(s) 563, 573
PaeR7I CTCGAG 1 cut(s) 6
PfeI GAWTC 2 cut(s) 589, 731
PflFI GACNNNGTC 1 cut(s) 110
PkrI GCNGC 2 cut(s) 15, 696
PleI GAGTC 2 cut(s) 127, 658
PpsI GAGTC 2 cut(s) 127, 658
Psp6I CCWGG 1 cut(s) 700
PspGI CCWGG 1 cut(s) 700
PsyI GACNNNGTC 1 cut(s) 110
RsaI GTAC 1 cut(s) 184
RsaNI GTAC 1 cut(s) 183
RseI CAYNNNNRTG 1 cut(s) 272
SatI GCNGC 2 cut(s) 14, 695
SchI GAGTC 2 cut(s) 128, 658
ScrFI CCNGG 1 cut(s) 702
SduI GDGCHC 1 cut(s) 328
SetI ASST 9 cut(s) 79, 104, 111, 294, 311, 406, 523, 611, 655
SfaNI GCATC 3 cut(s) 463, 540, 706
SfcI CTRYAG 1 cut(s) 78
Sfr274I CTCGAG 1 cut(s) 6
SlaI CTCGAG 1 cut(s) 6
SmiMI CAYNNNNRTG 1 cut(s) 272
SmlI CTYRAG 1 cut(s) 6
SmoI CTYRAG 1 cut(s) 6
SphI GCATGC 2 cut(s) 563, 573
Sse9I AATT 9 cut(s) 215, 231, 258, 281, 528, 620, 678, 688, 736
SsiI CCGC 2 cut(s) 505, 705
SspMI CTAG 2 cut(s) 606, 757
StyD4I CCNGG 1 cut(s) 700
StyI CCWWGG 1 cut(s) 646
TaqI TCGA 1 cut(s) 7
TasI AATT 9 cut(s) 215, 231, 258, 281, 528, 620, 678, 688, 736
TfiI GAWTC 2 cut(s) 589, 731
TseI GCWGC 2 cut(s) 13, 694
TspDTI ATGAA 1 cut(s) 78
Tth111I GACNNNGTC 1 cut(s) 110
XapI RAATTY 3 cut(s) 528, 678, 688
XceI RCATGY 3 cut(s) 34, 563, 573
XhoI CTCGAG 1 cut(s) 6
XspI CTAG 2 cut(s) 606, 757
Zsp2I ATGCAT 1 cut(s) 561
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.