Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000882.1

Orthogroup ID

OG0004887

Physical Location & Seq

Genomic Coordinates Reverse (-)

38257 .. 38763

Gene Structure 507 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000882.1_g000011.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 507 bp

ctgcgagaaaacccatcctcacgatcttgctcagctccggcagcatccttcctcaccatctcgttcggctccggcagcacaggaccgtcggatgcgacaactcagtcgtcgattccgttcttcattacctttctcagccggagctggcccaaacagagacgagctggagtagttcagcctcaaatcttcgaatccaaactgcaaacccatcgccgcgtcgtccaactccggccacttgataatctctcgacgcgaggtgaagaggctgaagacgaagcttcaaaggacaagatcgagagcgcaaagagctctcaacgacctaagattcatcggcaccgtcttccacatcaccagaccgcaaccactttagcttcatctaccagtaagttgaatcttcgtctccgccttcgaaggcaactccaacctcttctggaggcttcaacctcgttcctatcgcagagatctgagattgcatctaagctccgatttgaatccgtcaggatctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

168

Amino Acids

18.87

Weight (kDa)

11.33

Isoelectric Point (pI)

76.43

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004887)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr6g0259601
rosa_laevigata	RLG00000003103 RLG00000005636 RLG00000007694 RLG00000010541 RLG00000011298 RLG00000013218 RLG00000014056 RLG00000018752 RLG00000018929 RLG00000022584 RLG00000024077 RLG00000029574 RLG00000031864 RLG00000032289
rosa_multiflora	Rmu_sc0000882.1_g000011 Rmu_sc0003596.1_g000003
rosa_roxburghii	Rroxscaffold_1G00027440 Rroxscaffold_2G00124900 Rroxscaffold_2G00132880 Rroxscaffold_3G00227750 Rroxscaffold_5G00355680 Rroxscaffold_5G00358680 Rroxscaffold_6G00415500 Rroxscaffold_7G00201640 Rroxscaffold_7G00206380 Rroxscaffold_7G00206390
rosa_samantha	Rh1DG184900 Rh2CG167000 Rh7DG366000
rosa_wichuraiana	Rw1G018740

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	103
AccB1I	GGYRCC	1 cut(s)	333
AccII	CGCG	2 cut(s)	216, 253
AciI	CCGC	3 cut(s)	214, 357, 403
AcoI	YGGCCR	1 cut(s)	230
AcuI	CTGAAG	1 cut(s)	288
AgsI	TTSAA	4 cut(s)	282, 391, 441, 491
AluBI	AGCT	7 cut(s)	35, 144, 164, 278, 309, 371, 481
AluI	AGCT	7 cut(s)	35, 144, 164, 278, 309, 371, 481
Alw21I	GWGCWC	1 cut(s)	311
Alw26I	GTCTC	2 cut(s)	151, 404
AlwNI	CAGNNNCTG	1 cut(s)	504
AoxI	GGCC	2 cut(s)	146, 230
ApeKI	GCWGC	2 cut(s)	41, 75
AspLEI	GCGC	1 cut(s)	302
AspS9I	GGNCC	2 cut(s)	83, 147
AsuHPI	GGTGA	3 cut(s)	46, 269, 341
AsuII	TTCGAA	2 cut(s)	189, 409
AvaII	GGWCC	1 cut(s)	83
BanI	GGYRCC	1 cut(s)	333
BanII	GRGCYC	1 cut(s)	311
BbsI	GAAGAC	2 cut(s)	276, 332
Bbv12I	GWGCWC	1 cut(s)	311
BbvI	GCAGC	2 cut(s)	53, 87
BccI	CCATC	3 cut(s)	22, 65, 216
BcgI	CGANNNNNNTGC	2 cut(s)	191, 225
BcoDI	GTCTC	2 cut(s)	151, 404
BglII	AGATCT	1 cut(s)	461
BisI	GCNGC	3 cut(s)	42, 76, 214
BlpI	GCTNAGC	1 cut(s)	31
BlsI	GCNGC	3 cut(s)	43, 77, 215
Bme18I	GGWCC	1 cut(s)	83
BmgT120I	GGNCC	2 cut(s)	83, 147
BmiI	GGNNCC	2 cut(s)	70, 335
BmsI	GCATC	3 cut(s)	53, 82, 482
BpiI	GAAGAC	2 cut(s)	276, 332
BpmI	CTGGAG	2 cut(s)	186, 452
Bpu1102I	GCTNAGC	1 cut(s)	31
Bpu14I	TTCGAA	2 cut(s)	189, 409
BsaBI	GATNNNNATC	1 cut(s)	490
Bse1I	ACTGG	1 cut(s)	381
Bse8I	GATNNNNATC	1 cut(s)	490
BseGI	GGATG	3 cut(s)	14, 44, 97
BseJI	GATNNNNATC	1 cut(s)	490
BseMII	CTCAG	4 cut(s)	45, 116, 148, 456
BseNI	ACTGG	1 cut(s)	381
BseXI	GCAGC	2 cut(s)	53, 87
Bsh1236I	CGCG	2 cut(s)	216, 253
BshFI	GGCC	2 cut(s)	148, 232
BshNI	GGYRCC	1 cut(s)	333
BsiHKAI	GWGCWC	1 cut(s)	311
BsiSI	CCGG	4 cut(s)	38, 72, 139, 229
BsmAI	GTCTC	2 cut(s)	151, 404
BsmBI	CGTCTC	2 cut(s)	151, 404
BsnI	GGCC	2 cut(s)	148, 232
Bsp119I	TTCGAA	2 cut(s)	189, 409
Bsp1286I	GDGCHC	1 cut(s)	311
Bsp143I	GATC	4 cut(s)	23, 291, 461, 501
Bsp1720I	GCTNAGC	1 cut(s)	31
BspACI	CCGC	3 cut(s)	214, 357, 403
BspANI	GGCC	2 cut(s)	148, 232
BspCNI	CTCAG	4 cut(s)	44, 115, 147, 457
BspFNI	CGCG	2 cut(s)	216, 253
BspLI	GGNNCC	2 cut(s)	70, 335
BspT104I	TTCGAA	2 cut(s)	189, 409
BspT107I	GGYRCC	1 cut(s)	333
BsrI	ACTGG	1 cut(s)	381
BssMI	GATC	4 cut(s)	23, 291, 461, 501
Bst4CI	ACNGT	2 cut(s)	87, 338
Bst6I	CTCTTC	2 cut(s)	255, 432
BstBI	TTCGAA	2 cut(s)	189, 409
BstC8I	GCNNGC	1 cut(s)	146
BstDEI	CTNAG	6 cut(s)	31, 102, 134, 321, 465, 477
BstF5I	GGATG	3 cut(s)	14, 44, 97
BstFNI	CGCG	2 cut(s)	216, 253
BstHHI	GCGC	1 cut(s)	302
BstKTI	GATC	4 cut(s)	26, 294, 464, 504
BstMAI	GTCTC	2 cut(s)	151, 404
BstMBI	GATC	4 cut(s)	23, 291, 461, 501
BstMWI	GCNNNNNNNGC	3 cut(s)	41, 75, 306
BstUI	CGCG	2 cut(s)	216, 253
BstV1I	GCAGC	2 cut(s)	53, 87
BstV2I	GAAGAC	2 cut(s)	276, 332
BstX2I	RGATCY	2 cut(s)	461, 501
BstYI	RGATCY	2 cut(s)	461, 501
BsuRI	GGCC	2 cut(s)	148, 232
BtgZI	GCGATG	1 cut(s)	194
BtsCI	GGATG	3 cut(s)	14, 44, 97
Cac8I	GCNNGC	1 cut(s)	146
CaiI	CAGNNNCTG	1 cut(s)	504
CfoI	GCGC	1 cut(s)	302
Cfr13I	GGNCC	2 cut(s)	83, 147
CseI	GACGC	2 cut(s)	205, 259
DdeI	CTNAG	6 cut(s)	31, 102, 134, 321, 465, 477
DpnI	GATC	4 cut(s)	25, 293, 463, 503
DpnII	GATC	4 cut(s)	23, 291, 461, 501
DrdI	GACNNNNNNGTC	1 cut(s)	103
DseDI	GACNNNNNNGTC	1 cut(s)	103
EaeI	YGGCCR	1 cut(s)	230
Eam1104I	CTCTTC	2 cut(s)	255, 432
EarI	CTCTTC	2 cut(s)	255, 432
EciI	GGCGGA	1 cut(s)	392
Ecl136II	GAGCTC	1 cut(s)	309
Eco24I	GRGCYC	1 cut(s)	311
Eco47I	GGWCC	1 cut(s)	83
Eco53kI	GAGCTC	1 cut(s)	309
Eco57I	CTGAAG	1 cut(s)	288
EcoICRI	GAGCTC	1 cut(s)	309
EcoT38I	GRGCYC	1 cut(s)	311
Esp3I	CGTCTC	2 cut(s)	151, 404
Fnu4HI	GCNGC	3 cut(s)	42, 76, 214
FokI	GGATG	2 cut(s)	31, 104
FriOI	GRGCYC	1 cut(s)	311
Fsp4HI	GCNGC	3 cut(s)	42, 76, 214
GlaI	GCGC	1 cut(s)	301
GluI	GCNGC	3 cut(s)	42, 76, 214
GsuI	CTGGAG	2 cut(s)	186, 452
HaeIII	GGCC	2 cut(s)	148, 232
HapII	CCGG	4 cut(s)	38, 72, 139, 229
HgaI	GACGC	2 cut(s)	205, 259
HhaI	GCGC	1 cut(s)	302
Hin6I	GCGC	1 cut(s)	300
HinP1I	GCGC	1 cut(s)	300
HindIII	AAGCTT	1 cut(s)	276
HinfI	GANTC	5 cut(s)	112, 191, 325, 391, 491
HpaII	CCGG	4 cut(s)	38, 72, 139, 229
HphI	GGTGA	3 cut(s)	46, 269, 341
Hpy188I	TCNGA	4 cut(s)	91, 466, 485, 506
Hpy188III	TCNNGA	5 cut(s)	21, 247, 295, 431, 499
Hpy99I	CGWCG	4 cut(s)	91, 112, 221, 253
HpyAV	CCTTC	3 cut(s)	58, 405, 416
HpyCH4III	ACNGT	2 cut(s)	87, 338
HpyCH4V	TGCA	2 cut(s)	202, 473
HpyF10VI	GCNNNNNNNGC	3 cut(s)	41, 75, 306
HpyF3I	CTNAG	6 cut(s)	31, 102, 134, 321, 465, 477
HspAI	GCGC	1 cut(s)	300
Kzo9I	GATC	4 cut(s)	23, 291, 461, 501
LmnI	GCTCC	4 cut(s)	40, 74, 141, 486
Lsp1109I	GCAGC	2 cut(s)	53, 87
LweI	GCATC	3 cut(s)	53, 82, 482
MalI	GATC	4 cut(s)	25, 293, 463, 503
MboI	GATC	4 cut(s)	23, 291, 461, 501
MboII	GAAGA	7 cut(s)	112, 178, 272, 281, 332, 386, 419
MflI	RGATCY	2 cut(s)	461, 501
MhlI	GDGCHC	1 cut(s)	311
MmeI	TCCRAC	3 cut(s)	69, 247, 445
MnlI	CCTC	8 cut(s)	28, 62, 189, 248, 256, 427, 435, 454
MspI	CCGG	4 cut(s)	38, 72, 139, 229
MvnI	CGCG	2 cut(s)	216, 253
MwoI	GCNNNNNNNGC	3 cut(s)	41, 75, 306
NdeII	GATC	4 cut(s)	23, 291, 461, 501
NlaIV	GGNNCC	2 cut(s)	70, 335
NspV	TTCGAA	2 cut(s)	189, 409
PcsI	WCGNNNNNNNCGW	1 cut(s)	113
PfeI	GAWTC	5 cut(s)	112, 191, 325, 391, 491
PkrI	GCNGC	3 cut(s)	43, 77, 215
Psp124BI	GAGCTC	1 cut(s)	311
PspN4I	GGNNCC	2 cut(s)	70, 335
PspPI	GGNCC	2 cut(s)	83, 147
PstNI	CAGNNNCTG	1 cut(s)	504
PsuI	RGATCY	2 cut(s)	461, 501
SacI	GAGCTC	1 cut(s)	311
SatI	GCNGC	3 cut(s)	42, 76, 214
Sau3AI	GATC	4 cut(s)	23, 291, 461, 501
Sau96I	GGNCC	2 cut(s)	83, 147
SduI	GDGCHC	1 cut(s)	311
SfaNI	GCATC	3 cut(s)	53, 82, 482
SfuI	TTCGAA	2 cut(s)	189, 409
SinI	GGWCC	1 cut(s)	83
SsiI	CCGC	3 cut(s)	214, 357, 403
SstI	GAGCTC	1 cut(s)	311
TaaI	ACNGT	2 cut(s)	87, 338
TaqI	TCGA	5 cut(s)	110, 189, 248, 294, 409
TauI	GCSGC	1 cut(s)	216
TfiI	GAWTC	5 cut(s)	112, 191, 325, 391, 491
TseI	GCWGC	2 cut(s)	41, 75
TspDTI	ATGAA	3 cut(s)	112, 317, 363
TspGWI	ACGGA	2 cut(s)	105, 484
VpaK11BI	GGWCC	1 cut(s)	83

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.