Rmu_sc0001083.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001083.1
Physical Location & Seq
Forward (+)
1 .. 2715
2715 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001083.1_g000001.1.cds

Sequence Viewer

Length: 631 bp
tgcaccgtgtgcatcgtacttactccggaaaagagctctttacaatgacatgtcaagatatgtatgctgtgctggttatatgccctgcagtggtagatgtggggaaagtaaatgccctgaattttgcctggccactgaggtgtttttgtgctttgggaattccgtggcttcaactcgctttctgttgcaagatgaatttaatattcagaccacgcagtgtgataattgcatcattggtttcatggtctgcctacaacaagttgcatgtattttctccatagttgcgatgctagttggaagcgaagaaatctcagaggcgtctcagttattgaactgtttggctgacgtggtgtactgcagtgtgtgtgcatgtatgcagacacaacacaagatcgaaatggacaagcgtgatggcatgtttggaccccaaccaatggcagtacctcagtttcagcagatgtctcgcattgatcaacaaattcctcccaatgtcggatatcctcctcaaccagtatacgggcaaccctatgggtatccacctcctcctcaggctcaaggctatccacctcagcaggctcaaggctatcctccagctggataccctccacctggttatccaccttctaggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

209

Amino Acids

23.06

Weight (kDa)

5.09

Isoelectric Point (pI)

70.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 434
AccI GTMKAC 1 cut(s) 514
AccIII TCCGGA 1 cut(s) 25
AcoI YGGCCR 1 cut(s) 130
AcsI RAATTY 4 cut(s) 120, 158, 195, 478
AcyI GRCGYC 1 cut(s) 318
AdeI CACNNNGTG 2 cut(s) 9, 217
AfaI GTAC 3 cut(s) 18, 354, 442
AfiI CCNNNNNNNGG 6 cut(s) 90, 434, 492, 516, 594, 609
AflIII ACRYGT 1 cut(s) 49
AgsI TTSAA 2 cut(s) 172, 332
AjiI CACGTC 1 cut(s) 347
AjnI CCWGG 2 cut(s) 127, 608
AleI CACNNNNGTG 1 cut(s) 138
AluBI AGCT 2 cut(s) 36, 594
AluI AGCT 2 cut(s) 36, 594
Alw21I GWGCWC 1 cut(s) 38
Alw26I GTCTC 2 cut(s) 325, 466
Aor13HI TCCGGA 1 cut(s) 25
AoxI GGCC 1 cut(s) 130
ApoI RAATTY 4 cut(s) 120, 158, 195, 478
AspS9I GGNCC 1 cut(s) 423
AvaII GGWCC 1 cut(s) 423
AxyI CCTNAGG 1 cut(s) 547
BalI TGGCCA 1 cut(s) 132
BanII GRGCYC 1 cut(s) 38
Bbv12I GWGCWC 1 cut(s) 38
BbvCI CCTCAGC 1 cut(s) 568
BccI CCATC 1 cut(s) 405
BcgI CGANNNNNNTGC 2 cut(s) 444, 478
BciT130I CCWGG 2 cut(s) 129, 610
BciVI GTATCC 2 cut(s) 544, 591
BclI TGATCA 1 cut(s) 470
BcoDI GTCTC 2 cut(s) 325, 466
BfaI CTAG 2 cut(s) 291, 625
BfmI CTRYAG 2 cut(s) 86, 356
BfuI GTATCC 2 cut(s) 544, 591
Bme1390I CCNGG 2 cut(s) 129, 610
Bme18I GGWCC 1 cut(s) 423
BmgBI CACGTC 1 cut(s) 347
BmgT120I GGNCC 1 cut(s) 423
BmiI GGNNCC 1 cut(s) 425
BmrFI CCNGG 2 cut(s) 129, 610
BmsI GCATC 3 cut(s) 21, 238, 277
BpmI CTGGAG 1 cut(s) 574
Bpu10I CCTNAGC 1 cut(s) 568
BpuEI CTTGAG 2 cut(s) 538, 562
BsaHI GRCGYC 1 cut(s) 318
BsaJI CCNNGG 1 cut(s) 163
BsaWI WCCGGW 1 cut(s) 25
Bsc4I CCNNNNNNNGG 6 cut(s) 90, 434, 492, 516, 594, 609
Bse1I ACTGG 1 cut(s) 510
Bse21I CCTNAGG 1 cut(s) 547
BseAI TCCGGA 1 cut(s) 25
BseBI CCWGG 2 cut(s) 129, 610
BseDI CCNNGG 1 cut(s) 163
BseLI CCNNNNNNNGG 6 cut(s) 90, 434, 492, 516, 594, 609
BseMII CTCAG 6 cut(s) 127, 325, 336, 459, 561, 582
BseNI ACTGG 1 cut(s) 510
BseRI GAGGAG 3 cut(s) 493, 532, 535
BshFI GGCC 1 cut(s) 132
BsiHKAI GWGCWC 1 cut(s) 38
BsiSI CCGG 1 cut(s) 26
BslI CCNNNNNNNGG 6 cut(s) 90, 434, 492, 516, 594, 609
BsmAI GTCTC 2 cut(s) 325, 466
BsmBI CGTCTC 1 cut(s) 325
BsnI GGCC 1 cut(s) 132
Bsp1286I GDGCHC 1 cut(s) 38
Bsp13I TCCGGA 1 cut(s) 25
Bsp143I GATC 2 cut(s) 391, 470
BspANI GGCC 1 cut(s) 132
BspCNI CTCAG 6 cut(s) 128, 324, 335, 458, 560, 581
BspEI TCCGGA 1 cut(s) 25
BspLI GGNNCC 1 cut(s) 425
BspMAI CTGCAG 2 cut(s) 90, 360
BsrI ACTGG 1 cut(s) 510
BssECI CCNNGG 1 cut(s) 163
BssMI GATC 2 cut(s) 391, 470
BssNAI GTATAC 1 cut(s) 515
BssNI GRCGYC 1 cut(s) 318
Bst1107I GTATAC 1 cut(s) 515
Bst2UI CCWGG 2 cut(s) 129, 610
Bst4CI ACNGT 2 cut(s) 7, 336
BstACI GRCGYC 1 cut(s) 318
BstAPI GCANNNNNTGC 1 cut(s) 9
BstC8I GCNNGC 1 cut(s) 574
BstDEI CTNAG 6 cut(s) 136, 311, 322, 445, 547, 568
BstDSI CCRYGG 1 cut(s) 163
BstKTI GATC 2 cut(s) 394, 473
BstMAI GTCTC 2 cut(s) 325, 466
BstMBI GATC 2 cut(s) 391, 470
BstMWI GCNNNNNNNGC 1 cut(s) 9
BstNI CCWGG 2 cut(s) 129, 610
BstNSI RCATGY 4 cut(s) 53, 268, 373, 419
BstSCI CCNGG 2 cut(s) 127, 608
BstSFI CTRYAG 2 cut(s) 86, 356
BstZ17I GTATAC 1 cut(s) 515
Bsu36I CCTNAGG 1 cut(s) 547
BsuI GTATCC 2 cut(s) 544, 591
BsuRI GGCC 1 cut(s) 132
BtgI CCRYGG 1 cut(s) 163
BtgZI GCGATG 1 cut(s) 300
BtrI CACGTC 1 cut(s) 347
BtsI GCAGTG 3 cut(s) 95, 222, 365
BtsIMutI CAGTG 4 cut(s) 95, 133, 222, 365
Cac8I GCNNGC 1 cut(s) 574
Cfr13I GGNCC 1 cut(s) 423
CseI GACGC 1 cut(s) 307
CsiI ACCWGGT 1 cut(s) 608
Csp6I GTAC 3 cut(s) 17, 353, 441
CviAII CATG 5 cut(s) 50, 242, 265, 370, 416
CviJI RGCY 9 cut(s) 36, 132, 168, 342, 552, 559, 576, 583, 594
CviKI_1 RGCY 9 cut(s) 36, 132, 168, 342, 552, 559, 576, 583, 594
CviQI GTAC 3 cut(s) 17, 353, 441
DdeI CTNAG 6 cut(s) 136, 311, 322, 445, 547, 568
DpnI GATC 2 cut(s) 393, 472
DpnII GATC 2 cut(s) 391, 470
DraIII CACNNNGTG 2 cut(s) 9, 217
EaeI YGGCCR 1 cut(s) 130
Ecl136II GAGCTC 1 cut(s) 36
Eco24I GRGCYC 1 cut(s) 38
Eco32I GATATC 1 cut(s) 498
Eco47I GGWCC 1 cut(s) 423
Eco53kI GAGCTC 1 cut(s) 36
Eco81I CCTNAGG 1 cut(s) 547
EcoICRI GAGCTC 1 cut(s) 36
EcoRI GAATTC 1 cut(s) 158
EcoRII CCWGG 2 cut(s) 127, 608
EcoRV GATATC 1 cut(s) 498
EcoT38I GRGCYC 1 cut(s) 38
Esp3I CGTCTC 1 cut(s) 325
FaeI CATG 5 cut(s) 53, 245, 268, 373, 419
FatI CATG 5 cut(s) 49, 241, 264, 369, 415
FbaI TGATCA 1 cut(s) 470
FblI GTMKAC 1 cut(s) 514
FriOI GRGCYC 1 cut(s) 38
FspBI CTAG 2 cut(s) 291, 625
GsuI CTGGAG 1 cut(s) 574
HaeIII GGCC 1 cut(s) 132
HapII CCGG 1 cut(s) 26
HgaI GACGC 1 cut(s) 307
Hin1I GRCGYC 1 cut(s) 318
Hin1II CATG 5 cut(s) 53, 245, 268, 373, 419
HpaII CCGG 1 cut(s) 26
Hpy166II GTNNAC 2 cut(s) 353, 515
Hpy188I TCNGA 3 cut(s) 208, 314, 495
Hpy188III TCNNGA 2 cut(s) 26, 55
Hpy8I GTNNAC 2 cut(s) 353, 515
HpyAV CCTTC 1 cut(s) 631
HpyCH4III ACNGT 2 cut(s) 7, 336
HpyCH4IV ACGT 1 cut(s) 346
HpyCH4V TGCA 9 cut(s) 3, 12, 88, 188, 229, 264, 358, 369, 377
HpyF10VI GCNNNNNNNGC 1 cut(s) 9
HpyF3I CTNAG 6 cut(s) 136, 311, 322, 445, 547, 568
HpySE526I ACGT 1 cut(s) 346
Hsp92I GRCGYC 1 cut(s) 318
Hsp92II CATG 5 cut(s) 53, 245, 268, 373, 419
Kpn2I TCCGGA 1 cut(s) 25
Ksp22I TGATCA 1 cut(s) 470
Kzo9I GATC 2 cut(s) 391, 470
LweI GCATC 3 cut(s) 21, 238, 277
MabI ACCWGGT 1 cut(s) 608
MaeI CTAG 2 cut(s) 291, 625
MaeII ACGT 1 cut(s) 346
MalI GATC 2 cut(s) 393, 472
MboI GATC 2 cut(s) 391, 470
MboII GAAGA 1 cut(s) 315
MhlI GDGCHC 1 cut(s) 38
MlsI TGGCCA 1 cut(s) 132
MluCI AATT 5 cut(s) 120, 158, 195, 224, 478
MluNI TGGCCA 1 cut(s) 132
MmeI TCCRAC 2 cut(s) 275, 473
Mox20I TGGCCA 1 cut(s) 132
MroI TCCGGA 1 cut(s) 25
MscI TGGCCA 1 cut(s) 132
MseI TTAA 1 cut(s) 199
MslI CAYNNNNRTG 1 cut(s) 138
Msp20I TGGCCA 1 cut(s) 132
MspA1I CMGCKG 1 cut(s) 594
MspI CCGG 1 cut(s) 26
MspR9I CCNGG 2 cut(s) 129, 610
MvaI CCWGG 2 cut(s) 129, 610
MwoI GCNNNNNNNGC 1 cut(s) 9
NdeII GATC 2 cut(s) 391, 470
NlaIII CATG 5 cut(s) 53, 245, 268, 373, 419
NlaIV GGNNCC 1 cut(s) 425
NspI RCATGY 4 cut(s) 53, 268, 373, 419
OliI CACNNNNGTG 1 cut(s) 138
PciI ACATGT 1 cut(s) 49
PflMI CCANNNNNTGG 1 cut(s) 434
PscI ACATGT 1 cut(s) 49
Psp124BI GAGCTC 1 cut(s) 38
Psp6I CCWGG 2 cut(s) 127, 608
PspGI CCWGG 2 cut(s) 127, 608
PspN4I GGNNCC 1 cut(s) 425
PspPI GGNCC 1 cut(s) 423
PstI CTGCAG 2 cut(s) 90, 360
PvuII CAGCTG 1 cut(s) 594
RsaI GTAC 3 cut(s) 18, 354, 442
RsaNI GTAC 3 cut(s) 17, 353, 441
RseI CAYNNNNRTG 1 cut(s) 138
SacI GAGCTC 1 cut(s) 38
SaqAI TTAA 1 cut(s) 199
Sau3AI GATC 2 cut(s) 391, 470
Sau96I GGNCC 1 cut(s) 423
ScrFI CCNGG 2 cut(s) 129, 610
SduI GDGCHC 1 cut(s) 38
SexAI ACCWGGT 1 cut(s) 608
SfaNI GCATC 3 cut(s) 21, 238, 277
SfcI CTRYAG 2 cut(s) 86, 356
SinI GGWCC 1 cut(s) 423
SmiMI CAYNNNNRTG 1 cut(s) 138
SmlI CTYRAG 2 cut(s) 553, 577
SmoI CTYRAG 2 cut(s) 553, 577
Sse9I AATT 5 cut(s) 120, 158, 195, 224, 478
SspI AATATT 1 cut(s) 203
SspMI CTAG 2 cut(s) 291, 625
SstI GAGCTC 1 cut(s) 38
StyD4I CCNGG 2 cut(s) 127, 608
TaaI ACNGT 2 cut(s) 7, 336
TaiI ACGT 1 cut(s) 349
TaqI TCGA 1 cut(s) 394
TasI AATT 5 cut(s) 120, 158, 195, 224, 478
TatI WGTACW 1 cut(s) 352
Tru1I TTAA 1 cut(s) 199
Tru9I TTAA 1 cut(s) 199
TscAI CASTG 4 cut(s) 95, 140, 222, 365
TspDTI ATGAA 2 cut(s) 208, 230
TspGWI ACGGA 1 cut(s) 152
TspRI CASTG 4 cut(s) 95, 140, 222, 365
Van91I CCANNNNNTGG 1 cut(s) 434
VpaK11BI GGWCC 1 cut(s) 423
XapI RAATTY 4 cut(s) 120, 158, 195, 478
XceI RCATGY 4 cut(s) 53, 268, 373, 419
XmiI GTMKAC 1 cut(s) 514
XspI CTAG 2 cut(s) 291, 625
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.