Rmu_sc0002036.1_g000007

Short calmodulin-binding motif containing conserved Ile and Gln residues.

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002036.1
OG0003468
Physical Location & Seq
Reverse (-)
34577 .. 36172
1596 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002036.1_g000007.1.cds

Sequence Viewer

Length: 429 bp
atgttggataggaacctttcatttaaggaaacgttggggacagaagattgtagaggtaaaaatctgttgaagcttaaaccaatgctgacttttgctctgtctcaaccagattttatgttttggcctagactggttaaggagcttgatgatgcagcagtcaaagttcagaaagttttgtatatcaaactcgaagaaaccttgcagatcgtgcagtggtggctgaggaggtatgatggaaaccttttagattctgcagctctcaagcagagttctgtgtcattgttcgatgttgagaagccggaaaccgcctctttgtggctgaatgttggagatggcaaggaatcaaatcttgagctatgttcgaggacagtctacagagccaatgcatcaagtaccttggaccgaaagaaagaaaagcctatgaagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

142

Amino Acids

16.38

Weight (kDa)

8.85

Isoelectric Point (pI)

27.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 372
AciI CCGC 1 cut(s) 306
AclI AACGTT 1 cut(s) 32
AfaI GTAC 1 cut(s) 394
AfiI CCNNNNNNNGG 1 cut(s) 315
AgsI TTSAA 1 cut(s) 70
AluBI AGCT 4 cut(s) 73, 142, 257, 355
AluI AGCT 4 cut(s) 73, 142, 257, 355
Alw26I GTCTC 1 cut(s) 105
AoxI GGCC 1 cut(s) 122
ApeKI GCWGC 2 cut(s) 152, 254
AspS9I GGNCC 1 cut(s) 400
AvaII GGWCC 1 cut(s) 400
BbvCI CCTCAGC 1 cut(s) 221
BbvI GCAGC 2 cut(s) 164, 266
BccI CCATC 2 cut(s) 227, 326
BcoDI GTCTC 1 cut(s) 105
BfaI CTAG 1 cut(s) 126
BfmI CTRYAG 2 cut(s) 252, 373
BisI GCNGC 2 cut(s) 153, 255
BlsI GCNGC 2 cut(s) 154, 256
Bme18I GGWCC 1 cut(s) 400
BmgT120I GGNCC 1 cut(s) 400
BmiI GGNNCC 1 cut(s) 14
BmsI GCATC 2 cut(s) 139, 395
Bpu10I CCTNAGC 1 cut(s) 221
BpuEI CTTGAG 2 cut(s) 245, 371
BsaJI CCNNGG 1 cut(s) 396
Bsc4I CCNNNNNNNGG 1 cut(s) 315
Bse1I ACTGG 1 cut(s) 135
BseDI CCNNGG 1 cut(s) 396
BseLI CCNNNNNNNGG 1 cut(s) 315
BseMII CTCAG 1 cut(s) 212
BseNI ACTGG 1 cut(s) 135
BseRI GAGGAG 1 cut(s) 238
BseXI GCAGC 2 cut(s) 164, 266
BsgI GTGCAG 1 cut(s) 230
BshFI GGCC 1 cut(s) 124
BsiSI CCGG 1 cut(s) 299
BslFI GGGAC 1 cut(s) 52
BslI CCNNNNNNNGG 1 cut(s) 315
BsmAI GTCTC 1 cut(s) 105
BsmFI GGGAC 1 cut(s) 52
BsnI GGCC 1 cut(s) 124
Bsp143I GATC 1 cut(s) 204
BspACI CCGC 1 cut(s) 306
BspANI GGCC 1 cut(s) 124
BspCNI CTCAG 1 cut(s) 213
BspLI GGNNCC 1 cut(s) 14
BspMAI CTGCAG 1 cut(s) 256
BsrI ACTGG 1 cut(s) 135
BssECI CCNNGG 1 cut(s) 396
BssMI GATC 1 cut(s) 204
BssT1I CCWWGG 1 cut(s) 396
Bst4CI ACNGT 1 cut(s) 370
BstAPI GCANNNNNTGC 1 cut(s) 208
BstDEI CTNAG 1 cut(s) 221
BstKTI GATC 1 cut(s) 207
BstMAI GTCTC 1 cut(s) 105
BstMBI GATC 1 cut(s) 204
BstMWI GCNNNNNNNGC 2 cut(s) 208, 217
BstSFI CTRYAG 2 cut(s) 252, 373
BstV1I GCAGC 2 cut(s) 164, 266
BsuRI GGCC 1 cut(s) 124
BtsI GCAGTG 1 cut(s) 218
BtsIMutI CAGTG 1 cut(s) 218
Cfr13I GGNCC 1 cut(s) 400
Csp6I GTAC 1 cut(s) 393
CviQI GTAC 1 cut(s) 393
DdeI CTNAG 1 cut(s) 221
DpnI GATC 1 cut(s) 206
DpnII GATC 1 cut(s) 204
Eco130I CCWWGG 1 cut(s) 396
Eco47I GGWCC 1 cut(s) 400
EcoT14I CCWWGG 1 cut(s) 396
EcoT22I ATGCAT 1 cut(s) 388
ErhI CCWWGG 1 cut(s) 396
FaiI YATR 5 cut(s) 116, 180, 231, 358, 422
FaqI GGGAC 1 cut(s) 52
FblI GTMKAC 1 cut(s) 372
Fnu4HI GCNGC 2 cut(s) 153, 255
Fsp4HI GCNGC 2 cut(s) 153, 255
FspBI CTAG 1 cut(s) 126
GluI GCNGC 2 cut(s) 153, 255
HaeIII GGCC 1 cut(s) 124
HapII CCGG 1 cut(s) 299
HindIII AAGCTT 1 cut(s) 71
HinfI GANTC 2 cut(s) 248, 341
HpaII CCGG 1 cut(s) 299
Hpy166II GTNNAC 1 cut(s) 373
Hpy188I TCNGA 1 cut(s) 168
Hpy188III TCNNGA 1 cut(s) 350
Hpy8I GTNNAC 1 cut(s) 373
HpyCH4III ACNGT 1 cut(s) 370
HpyCH4IV ACGT 1 cut(s) 32
HpyCH4V TGCA 5 cut(s) 152, 202, 211, 254, 386
HpyF10VI GCNNNNNNNGC 2 cut(s) 208, 217
HpyF3I CTNAG 1 cut(s) 221
HpySE526I ACGT 1 cut(s) 32
Kzo9I GATC 1 cut(s) 204
LmnI GCTCC 1 cut(s) 139
LpnPI CCDG 3 cut(s) 116, 120, 312
Lsp1109I GCAGC 2 cut(s) 164, 266
LweI GCATC 2 cut(s) 139, 395
MaeI CTAG 1 cut(s) 126
MaeII ACGT 1 cut(s) 32
MalI GATC 1 cut(s) 206
MboI GATC 1 cut(s) 204
MboII GAAGA 2 cut(s) 56, 203
MmeI TCCRAC 1 cut(s) 307
MnlI CCTC 5 cut(s) 47, 216, 219, 319, 357
Mph1103I ATGCAT 1 cut(s) 388
MseI TTAA 3 cut(s) 24, 75, 135
MspI CCGG 1 cut(s) 299
MwoI GCNNNNNNNGC 2 cut(s) 208, 217
NdeII GATC 1 cut(s) 204
NlaIV GGNNCC 1 cut(s) 14
NsiI ATGCAT 1 cut(s) 388
PfeI GAWTC 2 cut(s) 248, 341
PkrI GCNGC 2 cut(s) 154, 256
Psp1406I AACGTT 1 cut(s) 32
PspN4I GGNNCC 1 cut(s) 14
PspPI GGNCC 1 cut(s) 400
PstI CTGCAG 1 cut(s) 256
RsaI GTAC 1 cut(s) 394
RsaNI GTAC 1 cut(s) 393
SaqAI TTAA 3 cut(s) 24, 75, 135
SatI GCNGC 2 cut(s) 153, 255
Sau3AI GATC 1 cut(s) 204
Sau96I GGNCC 1 cut(s) 400
SfaNI GCATC 2 cut(s) 139, 395
SfcI CTRYAG 2 cut(s) 252, 373
SinI GGWCC 1 cut(s) 400
SmlI CTYRAG 2 cut(s) 260, 350
SmoI CTYRAG 2 cut(s) 260, 350
SsiI CCGC 1 cut(s) 306
SspMI CTAG 1 cut(s) 126
StyI CCWWGG 1 cut(s) 396
TaaI ACNGT 1 cut(s) 370
TaiI ACGT 1 cut(s) 35
TaqI TCGA 3 cut(s) 189, 285, 362
TaqII GACCGA 1 cut(s) 417
TfiI GAWTC 2 cut(s) 248, 341
Tru1I TTAA 3 cut(s) 24, 75, 135
Tru9I TTAA 3 cut(s) 24, 75, 135
TscAI CASTG 1 cut(s) 218
TseI GCWGC 2 cut(s) 152, 254
TspDTI ATGAA 1 cut(s) 9
TspRI CASTG 1 cut(s) 218
VpaK11BI GGWCC 1 cut(s) 400
XmiI GTMKAC 1 cut(s) 372
XspI CTAG 1 cut(s) 126
Zsp2I ATGCAT 1 cut(s) 388
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.