Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005240.1

Orthogroup ID

OG0003468

Physical Location & Seq

Genomic Coordinates Reverse (-)

25175 .. 29472

Gene Structure 4298 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005240.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 435 bp

atgttgagaagctggaaatcgcctctttgtggtaggcaagggctaggactaggctgcgaagtaataacacttgctttgttatttcagattgcaaaaggtttgtctaaggatgagaaagcacaaaagttagctcttcaacattggcttgaagctattgatccacgccatcggctgaatgttggagatggcaaggaaacaaatcttgatctatgcttgaggacagttctacagagccaatgcatcaagtaccttggaccgatgtttgaacaccatatgcttggaagtctcttgggaggtggtttgatgatgagcaccggacgaagtcttgggcgcggtggggggtggttcaacgagggtcgcacttcatcgaggcacctccaagattggcaacatgatggaagggtgctggatcggctgcatcttggaaggtgttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

144

Amino Acids

16.09

Weight (kDa)

9.36

Isoelectric Point (pI)

42.31

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003468)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g08130
rosa_chinensis	RchiOBHm_Chr4g0393901 RchiOBHm_Chr4g0398321 RchiOBHm_Chr5g0053561 RchiOBHm_Chr5g0053581 RchiOBHm_Chr5g0053601 RchiOBHm_Chr6g0258141 RchiOBHm_Chr6g0258771 RchiOBHm_Chr6g0258791 RchiOBHm_Chr6g0258801
rosa_laevigata	RLG00000012857 RLG00000014120 RLG00000033861
rosa_multiflora	Rmu_sc0002036.1_g000007 Rmu_sc0005240.1_g000006 Rmu_ssc0000432.1_g000109
rosa_roxburghii	Rroxscaffold_1G00054950 Rroxscaffold_3G00228900 Rroxscaffold_4G00282600
rosa_rugosa	Rorug06G0348800
rosa_samantha	Rh1CG128400 Rh1DG140700 Rh3AG045400 Rh3CG136700 Rh3CG369500 Rh4AG078100 Rh5AG351900 Rh5AG352000 Rh5AG352100 Rh5AG466000 Rh5CG572800 Rh6AG011500 Rh6CG043300 Rh6CG248800
rosa_wichuraiana	Rw1G022960 Rw7G041590

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	372
AccII	CGCG	1 cut(s)	333
AciI	CCGC	1 cut(s)	333
AclWI	GGATC	2 cut(s)	152, 417
AfaI	GTAC	1 cut(s)	248
AfiI	CCNNNNNNNGG	1 cut(s)	29
AgsI	TTSAA	4 cut(s)	137, 149, 266, 349
AluBI	AGCT	3 cut(s)	12, 131, 152
AluI	AGCT	3 cut(s)	12, 131, 152
Alw21I	GWGCWC	1 cut(s)	314
Alw26I	GTCTC	1 cut(s)	290
AlwI	GGATC	2 cut(s)	152, 417
ApeKI	GCWGC	2 cut(s)	54, 415
ArsI	GACNNNNNNTTYG	2 cut(s)	86, 118
AspLEI	GCGC	1 cut(s)	333
AspS9I	GGNCC	1 cut(s)	254
AvaII	GGWCC	1 cut(s)	254
BanI	GGYRCC	1 cut(s)	372
Bbv12I	GWGCWC	1 cut(s)	314
BbvI	GCAGC	2 cut(s)	41, 402
BccI	CCATC	3 cut(s)	174, 179, 389
BcoDI	GTCTC	1 cut(s)	290
BfaI	CTAG	2 cut(s)	44, 50
BfmI	CTRYAG	1 cut(s)	227
BisI	GCNGC	2 cut(s)	55, 416
BlsI	GCNGC	2 cut(s)	56, 417
Bme18I	GGWCC	1 cut(s)	254
BmgT120I	GGNCC	1 cut(s)	254
BmiI	GGNNCC	1 cut(s)	374
BmsI	GCATC	2 cut(s)	249, 427
BpuEI	CTTGAG	1 cut(s)	235
BsaJI	CCNNGG	1 cut(s)	250
BsaWI	WCCGGW	1 cut(s)	314
Bsc4I	CCNNNNNNNGG	1 cut(s)	29
BseDI	CCNNGG	1 cut(s)	250
BseGI	GGATG	1 cut(s)	115
BseLI	CCNNNNNNNGG	1 cut(s)	29
BseXI	GCAGC	2 cut(s)	41, 402
Bsh1236I	CGCG	1 cut(s)	333
BshNI	GGYRCC	1 cut(s)	372
BsiHKAI	GWGCWC	1 cut(s)	314
BsiSI	CCGG	1 cut(s)	315
BslI	CCNNNNNNNGG	1 cut(s)	29
BsmAI	GTCTC	1 cut(s)	290
Bsp1286I	GDGCHC	1 cut(s)	314
Bsp143I	GATC	3 cut(s)	157, 205, 409
BspACI	CCGC	1 cut(s)	333
BspFNI	CGCG	1 cut(s)	333
BspLI	GGNNCC	1 cut(s)	374
BspPI	GGATC	2 cut(s)	152, 417
BspQI	GCTCTTC	1 cut(s)	138
BspT107I	GGYRCC	1 cut(s)	372
BssECI	CCNNGG	1 cut(s)	250
BssMI	GATC	3 cut(s)	157, 205, 409
BssT1I	CCWWGG	1 cut(s)	250
Bst4CI	ACNGT	1 cut(s)	223
Bst6I	CTCTTC	1 cut(s)	138
BstDEI	CTNAG	1 cut(s)	105
BstF5I	GGATG	1 cut(s)	115
BstFNI	CGCG	1 cut(s)	333
BstHHI	GCGC	1 cut(s)	333
BstKTI	GATC	3 cut(s)	160, 208, 412
BstMAI	GTCTC	1 cut(s)	290
BstMBI	GATC	3 cut(s)	157, 205, 409
BstMWI	GCNNNNNNNGC	1 cut(s)	412
BstSFI	CTRYAG	1 cut(s)	227
BstUI	CGCG	1 cut(s)	333
BstV1I	GCAGC	2 cut(s)	41, 402
BstXI	CCANNNNNNTGG	1 cut(s)	278
BtsCI	GGATG	1 cut(s)	115
CfoI	GCGC	1 cut(s)	333
Cfr13I	GGNCC	1 cut(s)	254
Csp6I	GTAC	1 cut(s)	247
CviAII	CATG	1 cut(s)	392
CviJI	RGCY	9 cut(s)	12, 43, 54, 131, 145, 152, 172, 234, 415
CviKI_1	RGCY	9 cut(s)	12, 43, 54, 131, 145, 152, 172, 234, 415
CviQI	GTAC	1 cut(s)	247
DdeI	CTNAG	1 cut(s)	105
DpnI	GATC	3 cut(s)	159, 207, 411
DpnII	GATC	3 cut(s)	157, 205, 409
Eam1104I	CTCTTC	1 cut(s)	138
EarI	CTCTTC	1 cut(s)	138
Eco130I	CCWWGG	1 cut(s)	250
Eco47I	GGWCC	1 cut(s)	254
EcoT14I	CCWWGG	1 cut(s)	250
EcoT22I	ATGCAT	1 cut(s)	242
ErhI	CCWWGG	1 cut(s)	250
FaeI	CATG	1 cut(s)	395
FaiI	YATR	4 cut(s)	211, 273, 275, 393
FatI	CATG	1 cut(s)	391
FauNDI	CATATG	1 cut(s)	273
Fnu4HI	GCNGC	2 cut(s)	55, 416
FokI	GGATG	1 cut(s)	122
Fsp4HI	GCNGC	2 cut(s)	55, 416
FspBI	CTAG	2 cut(s)	44, 50
GlaI	GCGC	1 cut(s)	332
GluI	GCNGC	2 cut(s)	55, 416
HapII	CCGG	1 cut(s)	315
HhaI	GCGC	1 cut(s)	333
Hin1II	CATG	1 cut(s)	395
Hin6I	GCGC	1 cut(s)	331
HinP1I	GCGC	1 cut(s)	331
HpaII	CCGG	1 cut(s)	315
Hpy188I	TCNGA	1 cut(s)	87
Hpy188III	TCNNGA	1 cut(s)	203
HpyAV	CCTTC	2 cut(s)	393, 420
HpyCH4III	ACNGT	1 cut(s)	223
HpyCH4V	TGCA	3 cut(s)	92, 240, 418
HpyF10VI	GCNNNNNNNGC	1 cut(s)	412
HpyF3I	CTNAG	1 cut(s)	105
Hsp92II	CATG	1 cut(s)	395
HspAI	GCGC	1 cut(s)	331
Kzo9I	GATC	3 cut(s)	157, 205, 409
LguI	GCTCTTC	1 cut(s)	138
LpnPI	CCDG	2 cut(s)	328, 392
Lsp1109I	GCAGC	2 cut(s)	41, 402
LweI	GCATC	2 cut(s)	249, 427
MaeI	CTAG	2 cut(s)	44, 50
MalI	GATC	3 cut(s)	159, 207, 411
MboI	GATC	3 cut(s)	157, 205, 409
MboII	GAAGA	1 cut(s)	125
MhlI	GDGCHC	1 cut(s)	314
MmeI	TCCRAC	1 cut(s)	160
MnlI	CCTC	6 cut(s)	33, 210, 287, 346, 363, 386
Mph1103I	ATGCAT	1 cut(s)	242
MspI	CCGG	1 cut(s)	315
MvnI	CGCG	1 cut(s)	333
MwoI	GCNNNNNNNGC	1 cut(s)	412
NdeI	CATATG	1 cut(s)	273
NdeII	GATC	3 cut(s)	157, 205, 409
NlaIII	CATG	1 cut(s)	395
NlaIV	GGNNCC	1 cut(s)	374
NsiI	ATGCAT	1 cut(s)	242
PciSI	GCTCTTC	1 cut(s)	138
PflFI	GACNNNGTC	1 cut(s)	321
PkrI	GCNGC	2 cut(s)	56, 417
PspN4I	GGNNCC	1 cut(s)	374
PspPI	GGNCC	1 cut(s)	254
PsyI	GACNNNGTC	1 cut(s)	321
RsaI	GTAC	1 cut(s)	248
RsaNI	GTAC	1 cut(s)	247
SapI	GCTCTTC	1 cut(s)	138
SatI	GCNGC	2 cut(s)	55, 416
Sau3AI	GATC	3 cut(s)	157, 205, 409
Sau96I	GGNCC	1 cut(s)	254
SduI	GDGCHC	1 cut(s)	314
SetI	ASST	8 cut(s)	14, 100, 133, 154, 252, 298, 378, 431
SfaNI	GCATC	2 cut(s)	249, 427
SfcI	CTRYAG	1 cut(s)	227
SinI	GGWCC	1 cut(s)	254
SmlI	CTYRAG	1 cut(s)	214
SmoI	CTYRAG	1 cut(s)	214
SsiI	CCGC	1 cut(s)	333
SspMI	CTAG	2 cut(s)	44, 50
StyI	CCWWGG	1 cut(s)	250
TaaI	ACNGT	1 cut(s)	223
TaqI	TCGA	1 cut(s)	368
TaqII	GACCGA	1 cut(s)	271
TseI	GCWGC	2 cut(s)	54, 415
TspDTI	ATGAA	1 cut(s)	354
Tth111I	GACNNNGTC	1 cut(s)	321
VpaK11BI	GGWCC	1 cut(s)	254
XspI	CTAG	2 cut(s)	44, 50
Zsp2I	ATGCAT	1 cut(s)	242

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.