Rmu_ssc0000432.1_g000109

Short calmodulin-binding motif containing conserved Ile and Gln residues.

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000432.1
OG0003468
Physical Location & Seq
Reverse (-)
380915 .. 382443
1529 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000432.1_g000109.1.cds

Sequence Viewer

Length: 492 bp
atgaacctttcgtttaagcctgaaaatgtaatgttggataggaacctttcatttaaggaaacgttggggacagaagattgtagaggtaaaaatctgttgaagcttaaaccaatgctgacttttgctctgtctcaaccggattttatgtttttgcctagactggttaaggagcttgatgatgcagcagtcaaagttcagaaagttttgtatatcaaactcgaagaaaccttacagatcgtgcagtggtgcctgaggaggtatgatggaaaccttttagattctgcagctctcaagcagagttctgtgtcattcttcgatgttgagaagctggaaatcgcctctttgtggctgaatgttggagatggcaaggaaacaaatcttgagctatgcttgaggacagttctacagagccaatgcatcaagtaccttggactgaaagaaagaaaagcctatgaagtagtagtcaaagatggcaacttaagctcatactaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

163

Amino Acids

18.7

Weight (kDa)

7.57

Isoelectric Point (pI)

32.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 246
AclI AACGTT 1 cut(s) 62
AfaI GTAC 1 cut(s) 425
AfiI CCNNNNNNNGG 1 cut(s) 345
AflII CTTAAG 1 cut(s) 478
AgsI TTSAA 1 cut(s) 100
AluBI AGCT 6 cut(s) 103, 172, 287, 328, 385, 483
AluI AGCT 6 cut(s) 103, 172, 287, 328, 385, 483
Alw26I GTCTC 1 cut(s) 135
ApeKI GCWGC 2 cut(s) 182, 284
AxyI CCTNAGG 1 cut(s) 251
BanI GGYRCC 1 cut(s) 246
BarI GAAGNNNNNNTAC 2 cut(s) 213, 245
BbvI GCAGC 2 cut(s) 194, 296
BccI CCATC 3 cut(s) 257, 356, 464
BcoDI GTCTC 1 cut(s) 135
BfaI CTAG 1 cut(s) 156
BfmI CTRYAG 2 cut(s) 282, 404
BfrI CTTAAG 1 cut(s) 478
BisI GCNGC 2 cut(s) 183, 285
BlsI GCNGC 2 cut(s) 184, 286
BmiI GGNNCC 2 cut(s) 44, 248
BmsI GCATC 2 cut(s) 169, 426
BpuEI CTTGAG 3 cut(s) 275, 401, 412
BsaJI CCNNGG 1 cut(s) 427
BsaWI WCCGGW 1 cut(s) 136
Bsc4I CCNNNNNNNGG 1 cut(s) 345
Bse1I ACTGG 1 cut(s) 165
Bse21I CCTNAGG 1 cut(s) 251
BseDI CCNNGG 1 cut(s) 427
BseLI CCNNNNNNNGG 1 cut(s) 345
BseMII CTCAG 1 cut(s) 242
BseNI ACTGG 1 cut(s) 165
BseRI GAGGAG 1 cut(s) 268
BseXI GCAGC 2 cut(s) 194, 296
BsgI GTGCAG 1 cut(s) 260
BshNI GGYRCC 1 cut(s) 246
BsiSI CCGG 1 cut(s) 137
BslFI GGGAC 1 cut(s) 82
BslI CCNNNNNNNGG 1 cut(s) 345
BsmAI GTCTC 1 cut(s) 135
BsmFI GGGAC 1 cut(s) 82
Bsp143I GATC 1 cut(s) 234
BspCNI CTCAG 1 cut(s) 243
BspLI GGNNCC 2 cut(s) 44, 248
BspMAI CTGCAG 1 cut(s) 286
BspT107I GGYRCC 1 cut(s) 246
BspTI CTTAAG 1 cut(s) 478
BsrI ACTGG 1 cut(s) 165
BssECI CCNNGG 1 cut(s) 427
BssMI GATC 1 cut(s) 234
BssT1I CCWWGG 1 cut(s) 427
Bst4CI ACNGT 1 cut(s) 400
BstAFI CTTAAG 1 cut(s) 478
BstDEI CTNAG 1 cut(s) 251
BstKTI GATC 1 cut(s) 237
BstMAI GTCTC 1 cut(s) 135
BstMBI GATC 1 cut(s) 234
BstMWI GCNNNNNNNGC 1 cut(s) 480
BstSFI CTRYAG 2 cut(s) 282, 404
BstV1I GCAGC 2 cut(s) 194, 296
Bsu36I CCTNAGG 1 cut(s) 251
BtsI GCAGTG 1 cut(s) 248
BtsIMutI CAGTG 1 cut(s) 248
Csp6I GTAC 1 cut(s) 424
CviQI GTAC 1 cut(s) 424
DdeI CTNAG 1 cut(s) 251
DpnI GATC 1 cut(s) 236
DpnII GATC 1 cut(s) 234
Eco130I CCWWGG 1 cut(s) 427
Eco81I CCTNAGG 1 cut(s) 251
EcoT14I CCWWGG 1 cut(s) 427
EcoT22I ATGCAT 1 cut(s) 419
ErhI CCWWGG 1 cut(s) 427
FaiI YATR 6 cut(s) 146, 210, 261, 388, 453, 487
FaqI GGGAC 1 cut(s) 82
Fnu4HI GCNGC 2 cut(s) 183, 285
Fsp4HI GCNGC 2 cut(s) 183, 285
FspBI CTAG 1 cut(s) 156
GluI GCNGC 2 cut(s) 183, 285
HapII CCGG 1 cut(s) 137
HindIII AAGCTT 1 cut(s) 101
HinfI GANTC 1 cut(s) 278
HpaII CCGG 1 cut(s) 137
Hpy188I TCNGA 1 cut(s) 198
Hpy188III TCNNGA 1 cut(s) 380
HpyCH4III ACNGT 1 cut(s) 400
HpyCH4IV ACGT 1 cut(s) 62
HpyCH4V TGCA 4 cut(s) 182, 241, 284, 417
HpyF10VI GCNNNNNNNGC 1 cut(s) 480
HpyF3I CTNAG 1 cut(s) 251
HpySE526I ACGT 1 cut(s) 62
Kzo9I GATC 1 cut(s) 234
LmnI GCTCC 1 cut(s) 169
LpnPI CCDG 5 cut(s) 33, 146, 150, 263, 314
Lsp1109I GCAGC 2 cut(s) 194, 296
LweI GCATC 2 cut(s) 169, 426
MaeI CTAG 1 cut(s) 156
MaeII ACGT 1 cut(s) 62
MalI GATC 1 cut(s) 236
MboI GATC 1 cut(s) 234
MboII GAAGA 3 cut(s) 86, 233, 304
MmeI TCCRAC 2 cut(s) 15, 337
MnlI CCTC 5 cut(s) 77, 246, 249, 349, 387
Mph1103I ATGCAT 1 cut(s) 419
MseI TTAA 5 cut(s) 15, 54, 105, 165, 479
MspCI CTTAAG 1 cut(s) 478
MspI CCGG 1 cut(s) 137
MwoI GCNNNNNNNGC 1 cut(s) 480
NdeII GATC 1 cut(s) 234
NlaIV GGNNCC 2 cut(s) 44, 248
NsiI ATGCAT 1 cut(s) 419
PfeI GAWTC 1 cut(s) 278
PkrI GCNGC 2 cut(s) 184, 286
Psp1406I AACGTT 1 cut(s) 62
PspN4I GGNNCC 2 cut(s) 44, 248
PstI CTGCAG 1 cut(s) 286
RsaI GTAC 1 cut(s) 425
RsaNI GTAC 1 cut(s) 424
SaqAI TTAA 5 cut(s) 15, 54, 105, 165, 479
SatI GCNGC 2 cut(s) 183, 285
Sau3AI GATC 1 cut(s) 234
SfaNI GCATC 2 cut(s) 169, 426
SfcI CTRYAG 2 cut(s) 282, 404
SmlI CTYRAG 4 cut(s) 290, 380, 391, 478
SmoI CTYRAG 4 cut(s) 290, 380, 391, 478
SspMI CTAG 1 cut(s) 156
StyI CCWWGG 1 cut(s) 427
TaaI ACNGT 1 cut(s) 400
TaiI ACGT 1 cut(s) 65
TaqI TCGA 2 cut(s) 219, 315
TfiI GAWTC 1 cut(s) 278
Tru1I TTAA 5 cut(s) 15, 54, 105, 165, 479
Tru9I TTAA 5 cut(s) 15, 54, 105, 165, 479
TscAI CASTG 1 cut(s) 248
TseI GCWGC 2 cut(s) 182, 284
TspDTI ATGAA 3 cut(s) 17, 39, 468
TspRI CASTG 1 cut(s) 248
Vha464I CTTAAG 1 cut(s) 478
XspI CTAG 1 cut(s) 156
Zsp2I ATGCAT 1 cut(s) 419
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.