Rh1DG140700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
29738551 .. 29741185
2635 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG140700.1

Sequence Viewer

Length: 189 bp
ATGCTTCCCAAGAAGCTACCTACTTATTCAGCTCCCTCCGAAGGCACAAATTCTGCAACAAAGTCTTCTTCCAAAGCCTTTGAAGCTCATAGGAACCTCCCTTCATTAGATGGAAAGGGACTTTCAGGATTGTACATATTGAAGGGGGAGAGATTTGGACTGAAAACAAAGAAAAGAGGAAGTTCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.63

Weight (kDa)

10.23

Isoelectric Point (pI)

35.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 49
AfaI GTAC 1 cut(s) 134
AfiI CCNNNNNNNGG 1 cut(s) 41
AgsI TTSAA 2 cut(s) 83, 142
AluBI AGCT 3 cut(s) 16, 32, 86
AluI AGCT 3 cut(s) 16, 32, 86
ApoI RAATTY 1 cut(s) 49
BbsI GAAGAC 1 cut(s) 57
BccI CCATC 1 cut(s) 104
BmiI GGNNCC 1 cut(s) 95
BpiI GAAGAC 1 cut(s) 57
Bsc4I CCNNNNNNNGG 1 cut(s) 41
BseLI CCNNNNNNNGG 1 cut(s) 41
BslFI GGGAC 1 cut(s) 132
BslI CCNNNNNNNGG 1 cut(s) 41
BsmFI GGGAC 1 cut(s) 132
Bsp1407I TGTACA 1 cut(s) 132
BspLI GGNNCC 1 cut(s) 95
BsrGI TGTACA 1 cut(s) 132
BstAUI TGTACA 1 cut(s) 132
BstMWI GCNNNNNNNGC 1 cut(s) 83
BstV2I GAAGAC 1 cut(s) 57
Csp6I GTAC 1 cut(s) 133
CviJI RGCY 4 cut(s) 16, 32, 77, 86
CviKI_1 RGCY 4 cut(s) 16, 32, 77, 86
CviQI GTAC 1 cut(s) 133
FaiI YATR 3 cut(s) 90, 137, 187
FaqI GGGAC 1 cut(s) 132
Hpy188I TCNGA 1 cut(s) 40
Hpy188III TCNNGA 1 cut(s) 126
HpyAV CCTTC 3 cut(s) 35, 111, 136
HpyCH4V TGCA 1 cut(s) 56
HpyF10VI GCNNNNNNNGC 1 cut(s) 83
LmnI GCTCC 1 cut(s) 37
LpnPI CCDG 1 cut(s) 111
MboII GAAGA 2 cut(s) 57, 60
MluCI AATT 1 cut(s) 49
MnlI CCTC 3 cut(s) 46, 107, 170
MwoI GCNNNNNNNGC 1 cut(s) 83
NlaIV GGNNCC 1 cut(s) 95
PspN4I GGNNCC 1 cut(s) 95
RsaI GTAC 1 cut(s) 134
RsaNI GTAC 1 cut(s) 133
SetI ASST 5 cut(s) 18, 22, 34, 88, 99
SgeI CNNG 2 cut(s) 22, 138
Sse9I AATT 1 cut(s) 49
TasI AATT 1 cut(s) 49
TatI WGTACW 1 cut(s) 132
TspDTI ATGAA 2 cut(s) 93, 174
XapI RAATTY 1 cut(s) 49
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.