Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr3A

Orthogroup ID

OG0003468

Physical Location & Seq

Genomic Coordinates Reverse (-)

3135095 .. 3141212

Gene Structure 6118 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh3AG045400.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 432 bp

ATGGAGATTGGAAAAGGTTTATCTAAGGATGAGAAAGCACAAAAGTTAGCTCTTCAACATTGGCTTGAAGCTATTGATCCACGCCATTGGTATAGACACAATTTACACATGTACTATGATTTGTGGTTTGAAAGTCAGAGCAGCCAGCCTTTCTTCTACTGGCTGGATGTTGGAGATGCAAAGAAACAAATCTTGAGATATGCTCGAGGGCAGTTCTACAGAGCCAATGCATCAAGTACCTTGGACCAAAAGAAAGAAAAGCCTATGAAAGTGACGGAGAGGACGAAAGTTTCTTTTCTTTGTGCTGCAACTCGAGATCGAGAGAGGGAGAGAGAGAGCGAGAGCGTGTTGATATTCTGGAAAGGTAGACAACAAACAGAGGGCCGAAAGGGTCTCATCTCAGGTCAGTGTACCATGCAGCAGCCTATTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

143

Amino Acids

17.02

Weight (kDa)

9.49

Isoelectric Point (pI)

49.28

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003468)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g08130
rosa_chinensis	RchiOBHm_Chr4g0393901 RchiOBHm_Chr4g0398321 RchiOBHm_Chr5g0053561 RchiOBHm_Chr5g0053581 RchiOBHm_Chr5g0053601 RchiOBHm_Chr6g0258141 RchiOBHm_Chr6g0258771 RchiOBHm_Chr6g0258791 RchiOBHm_Chr6g0258801
rosa_laevigata	RLG00000012857 RLG00000014120 RLG00000033861
rosa_multiflora	Rmu_sc0002036.1_g000007 Rmu_sc0005240.1_g000006 Rmu_ssc0000432.1_g000109
rosa_roxburghii	Rroxscaffold_1G00054950 Rroxscaffold_3G00228900 Rroxscaffold_4G00282600
rosa_rugosa	Rorug06G0348800
rosa_samantha	Rh1CG128400 Rh1DG140700 Rh3AG045400 Rh3CG136700 Rh3CG369500 Rh4AG078100 Rh5AG351900 Rh5AG352000 Rh5AG352100 Rh5AG466000 Rh5CG572800 Rh6AG011500 Rh6CG043300 Rh6CG248800
rosa_wichuraiana	Rw1G022960 Rw7G041590

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	367
AclWI	GGATC	1 cut(s)	71
AfaI	GTAC	3 cut(s)	113, 238, 412
AflIII	ACRYGT	1 cut(s)	108
AgsI	TTSAA	3 cut(s)	56, 68, 131
AluBI	AGCT	2 cut(s)	50, 71
AluI	AGCT	2 cut(s)	50, 71
Alw26I	GTCTC	1 cut(s)	398
AlwI	GGATC	1 cut(s)	71
Ama87I	CYCGRG	2 cut(s)	204, 312
AoxI	GGCC	1 cut(s)	382
ApeKI	GCWGC	4 cut(s)	141, 305, 418, 421
AspS9I	GGNCC	2 cut(s)	244, 382
AvaI	CYCGRG	2 cut(s)	204, 312
AvaII	GGWCC	1 cut(s)	244
BbvI	GCAGC	2 cut(s)	153, 292
BcoDI	GTCTC	1 cut(s)	398
BfmI	CTRYAG	1 cut(s)	217
BisI	GCNGC	4 cut(s)	142, 306, 419, 422
BlsI	GCNGC	4 cut(s)	143, 307, 420, 423
Bme18I	GGWCC	1 cut(s)	244
BmeT110I	CYCGRG	2 cut(s)	204, 312
BmgT120I	GGNCC	2 cut(s)	244, 382
BmsI	GCATC	2 cut(s)	166, 239
BplI	GAGNNNNNCTC	2 cut(s)	187, 219
BpuEI	CTTGAG	1 cut(s)	214
BsaI	GGTCTC	1 cut(s)	398
BsaJI	CCNNGG	1 cut(s)	240
Bse1I	ACTGG	1 cut(s)	164
BseDI	CCNNGG	1 cut(s)	240
BseGI	GGATG	2 cut(s)	34, 172
BseMII	CTCAG	1 cut(s)	414
BseNI	ACTGG	1 cut(s)	164
BseXI	GCAGC	2 cut(s)	153, 292
BshFI	GGCC	1 cut(s)	384
BsiHKCI	CYCGRG	2 cut(s)	204, 312
BsmAI	GTCTC	1 cut(s)	398
BsnI	GGCC	1 cut(s)	384
Bso31I	GGTCTC	1 cut(s)	398
BsoBI	CYCGRG	2 cut(s)	204, 312
Bsp143I	GATC	2 cut(s)	76, 316
BspANI	GGCC	1 cut(s)	384
BspCNI	CTCAG	1 cut(s)	413
BspPI	GGATC	1 cut(s)	71
BspQI	GCTCTTC	1 cut(s)	57
BspTNI	GGTCTC	1 cut(s)	398
BsrI	ACTGG	1 cut(s)	164
BssECI	CCNNGG	1 cut(s)	240
BssMI	GATC	2 cut(s)	76, 316
BssT1I	CCWWGG	1 cut(s)	240
Bst6I	CTCTTC	1 cut(s)	57
BstC8I	GCNNGC	1 cut(s)	146
BstDEI	CTNAG	2 cut(s)	24, 400
BstF5I	GGATG	2 cut(s)	34, 172
BstKTI	GATC	2 cut(s)	79, 319
BstMAI	GTCTC	1 cut(s)	398
BstMBI	GATC	2 cut(s)	76, 316
BstNSI	RCATGY	1 cut(s)	112
BstSFI	CTRYAG	1 cut(s)	217
BstV1I	GCAGC	2 cut(s)	153, 292
BstXI	CCANNNNNNTGG	1 cut(s)	87
BsuRI	GGCC	1 cut(s)	384
BtsCI	GGATG	2 cut(s)	34, 172
BtsIMutI	CAGTG	1 cut(s)	413
Cac8I	GCNNGC	1 cut(s)	146
Cfr13I	GGNCC	2 cut(s)	244, 382
Csp6I	GTAC	3 cut(s)	112, 237, 411
CviAII	CATG	2 cut(s)	109, 415
CviQI	GTAC	3 cut(s)	112, 237, 411
DdeI	CTNAG	2 cut(s)	24, 400
DpnI	GATC	2 cut(s)	78, 318
DpnII	GATC	2 cut(s)	76, 316
Eam1104I	CTCTTC	1 cut(s)	57
EarI	CTCTTC	1 cut(s)	57
Eco130I	CCWWGG	1 cut(s)	240
Eco31I	GGTCTC	1 cut(s)	398
Eco47I	GGWCC	1 cut(s)	244
Eco88I	CYCGRG	2 cut(s)	204, 312
EcoT14I	CCWWGG	1 cut(s)	240
EcoT22I	ATGCAT	1 cut(s)	232
ErhI	CCWWGG	1 cut(s)	240
FaeI	CATG	2 cut(s)	112, 418
FaiI	YATR	6 cut(s)	93, 110, 117, 201, 266, 416
FatI	CATG	2 cut(s)	108, 414
FblI	GTMKAC	1 cut(s)	367
Fnu4HI	GCNGC	4 cut(s)	142, 306, 419, 422
FokI	GGATG	2 cut(s)	41, 179
Fsp4HI	GCNGC	4 cut(s)	142, 306, 419, 422
GluI	GCNGC	4 cut(s)	142, 306, 419, 422
HaeIII	GGCC	1 cut(s)	384
Hin1II	CATG	2 cut(s)	112, 418
Hpy166II	GTNNAC	2 cut(s)	368, 411
Hpy188I	TCNGA	1 cut(s)	138
Hpy188III	TCNNGA	4 cut(s)	193, 314, 320, 358
Hpy8I	GTNNAC	2 cut(s)	368, 411
HpyCH4V	TGCA	4 cut(s)	179, 230, 308, 418
HpyF3I	CTNAG	2 cut(s)	24, 400
Hsp92II	CATG	2 cut(s)	112, 418
Kzo9I	GATC	2 cut(s)	76, 316
LguI	GCTCTTC	1 cut(s)	57
LpnPI	CCDG	5 cut(s)	145, 149, 158, 343, 387
Lsp1109I	GCAGC	2 cut(s)	153, 292
LweI	GCATC	2 cut(s)	166, 239
MaeIII	GTNAC	1 cut(s)	271
MalI	GATC	2 cut(s)	78, 318
MboI	GATC	2 cut(s)	76, 316
MboII	GAAGA	2 cut(s)	44, 145
MluCI	AATT	1 cut(s)	100
MmeI	TCCRAC	1 cut(s)	151
MnlI	CCTC	4 cut(s)	200, 273, 318, 373
Mph1103I	ATGCAT	1 cut(s)	232
NdeII	GATC	2 cut(s)	76, 316
NlaIII	CATG	2 cut(s)	112, 418
NmuCI	GTSAC	1 cut(s)	271
NsiI	ATGCAT	1 cut(s)	232
NspI	RCATGY	1 cut(s)	112
PaeR7I	CTCGAG	2 cut(s)	204, 312
PciI	ACATGT	1 cut(s)	108
PciSI	GCTCTTC	1 cut(s)	57
PcsI	WCGNNNNNNNCGW	1 cut(s)	281
PkrI	GCNGC	4 cut(s)	143, 307, 420, 423
PscI	ACATGT	1 cut(s)	108
PspPI	GGNCC	2 cut(s)	244, 382
PspXI	VCTCGAGB	1 cut(s)	204
RsaI	GTAC	3 cut(s)	113, 238, 412
RsaNI	GTAC	3 cut(s)	112, 237, 411
SapI	GCTCTTC	1 cut(s)	57
SatI	GCNGC	4 cut(s)	142, 306, 419, 422
Sau3AI	GATC	2 cut(s)	76, 316
Sau96I	GGNCC	2 cut(s)	244, 382
SetI	ASST	6 cut(s)	19, 52, 73, 242, 367, 406
SfaNI	GCATC	2 cut(s)	166, 239
SfcI	CTRYAG	1 cut(s)	217
Sfr274I	CTCGAG	2 cut(s)	204, 312
SinI	GGWCC	1 cut(s)	244
SlaI	CTCGAG	2 cut(s)	204, 312
SmlI	CTYRAG	3 cut(s)	193, 204, 312
SmoI	CTYRAG	3 cut(s)	193, 204, 312
Sse9I	AATT	1 cut(s)	100
StyI	CCWWGG	1 cut(s)	240
TaqI	TCGA	3 cut(s)	205, 313, 319
TasI	AATT	1 cut(s)	100
TatI	WGTACW	1 cut(s)	111
TscAI	CASTG	1 cut(s)	413
TseFI	GTSAC	1 cut(s)	271
TseI	GCWGC	4 cut(s)	141, 305, 418, 421
Tsp45I	GTSAC	1 cut(s)	271
TspDTI	ATGAA	1 cut(s)	281
TspGWI	ACGGA	1 cut(s)	290
TspRI	CASTG	1 cut(s)	413
VpaK11BI	GGWCC	1 cut(s)	244
XceI	RCATGY	1 cut(s)	112
XhoI	CTCGAG	2 cut(s)	204, 312
XmiI	GTMKAC	1 cut(s)	367
Zsp2I	ATGCAT	1 cut(s)	232

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.