Rmu_sc0002151.1_g000001

RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002151.1
Physical Location & Seq
Forward (+)
390 .. 749
360 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002151.1_g000001.1.cds

Sequence Viewer

Length: 360 bp
atgcctggggtttatggtgtagatgctgtgagtgttagtgttcatggtgaacctggtcttactgtaacagcaggggctggttttccaactcctttacaagctcagactttaccaaaccaaagacatgaggtcggagctggcattggctcaagtgtttctactgactttagtagagaaaggtatgtgccttcaaggagtggtgatggtcttccagtcctaaaaggggaatcatacattttgtttgtggatggtcttcccactgactataccagaagagaagtaggccgtatccttttgcttttcgtgtgtctatttttgcatgcctgtgaatgttttaggtatgcaacatttccaggataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

119

Amino Acids

12.75

Weight (kDa)

5.84

Isoelectric Point (pI)

47.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 223
AgsI TTSAA 1 cut(s) 192
AhdI GACNNNNNGTC 1 cut(s) 128
AjnI CCWGG 3 cut(s) 4, 52, 352
AluBI AGCT 2 cut(s) 101, 137
AluI AGCT 2 cut(s) 101, 137
AlwNI CAGNNNCTG 1 cut(s) 77
AoxI GGCC 1 cut(s) 283
AsuHPI GGTGA 2 cut(s) 59, 212
BbsI GAAGAC 2 cut(s) 200, 245
BccI CCATC 2 cut(s) 197, 242
BceAI ACGGC 1 cut(s) 270
BciT130I CCWGG 3 cut(s) 6, 54, 354
BciVI GTATCC 1 cut(s) 299
BfuI GTATCC 1 cut(s) 299
Bme1390I CCNGG 3 cut(s) 6, 54, 354
BmeRI GACNNNNNGTC 1 cut(s) 128
BmrFI CCNGG 3 cut(s) 6, 54, 354
BmsI GCATC 1 cut(s) 13
BpiI GAAGAC 2 cut(s) 200, 245
BpuEI CTTGAG 1 cut(s) 133
BsaJI CCNNGG 1 cut(s) 5
Bsc4I CCNNNNNNNGG 1 cut(s) 223
Bse1I ACTGG 1 cut(s) 212
BseBI CCWGG 3 cut(s) 6, 54, 354
BseDI CCNNGG 1 cut(s) 5
BseGI GGATG 1 cut(s) 253
BseLI CCNNNNNNNGG 1 cut(s) 223
BseMII CTCAG 1 cut(s) 116
BseNI ACTGG 1 cut(s) 212
BshFI GGCC 1 cut(s) 285
BslI CCNNNNNNNGG 1 cut(s) 223
BsnI GGCC 1 cut(s) 285
BspANI GGCC 1 cut(s) 285
BspCNI CTCAG 1 cut(s) 115
BsrI ACTGG 1 cut(s) 212
BssECI CCNNGG 1 cut(s) 5
Bst2UI CCWGG 3 cut(s) 6, 54, 354
Bst4CI ACNGT 1 cut(s) 64
Bst6I CTCTTC 1 cut(s) 268
BstC8I GCNNGC 2 cut(s) 139, 321
BstDEI CTNAG 1 cut(s) 102
BstF5I GGATG 1 cut(s) 253
BstNI CCWGG 3 cut(s) 6, 54, 354
BstNSI RCATGY 1 cut(s) 323
BstSCI CCNGG 3 cut(s) 4, 52, 352
BstV2I GAAGAC 2 cut(s) 200, 245
BsuI GTATCC 1 cut(s) 299
BsuRI GGCC 1 cut(s) 285
BtsCI GGATG 1 cut(s) 253
BtsIMutI CAGTG 1 cut(s) 258
Cac8I GCNNGC 2 cut(s) 139, 321
CaiI CAGNNNCTG 1 cut(s) 77
CsiI ACCWGGT 1 cut(s) 52
CviAII CATG 3 cut(s) 44, 125, 320
CviJI RGCY 5 cut(s) 77, 101, 137, 147, 285
CviKI_1 RGCY 5 cut(s) 77, 101, 137, 147, 285
DdeI CTNAG 1 cut(s) 102
DriI GACNNNNNGTC 1 cut(s) 128
Eam1104I CTCTTC 1 cut(s) 268
Eam1105I GACNNNNNGTC 1 cut(s) 128
EarI CTCTTC 1 cut(s) 268
EcoRII CCWGG 3 cut(s) 4, 52, 352
FaeI CATG 3 cut(s) 47, 128, 323
FaiI YATR 8 cut(s) 15, 45, 126, 183, 232, 267, 321, 342
FatI CATG 3 cut(s) 43, 124, 319
FokI GGATG 1 cut(s) 260
HaeIII GGCC 1 cut(s) 285
Hin1II CATG 3 cut(s) 47, 128, 323
HinfI GANTC 1 cut(s) 227
HphI GGTGA 2 cut(s) 59, 212
Hpy166II GTNNAC 1 cut(s) 50
Hpy188I TCNGA 2 cut(s) 105, 134
Hpy8I GTNNAC 1 cut(s) 50
HpyAV CCTTC 1 cut(s) 198
HpyCH4III ACNGT 1 cut(s) 64
HpyCH4V TGCA 2 cut(s) 319, 344
HpyF3I CTNAG 1 cut(s) 102
Hsp92II CATG 3 cut(s) 47, 128, 323
LmnI GCTCC 1 cut(s) 134
LweI GCATC 1 cut(s) 13
MabI ACCWGGT 1 cut(s) 52
MaeIII GTNAC 1 cut(s) 64
MboII GAAGA 3 cut(s) 200, 245, 285
MmeI TCCRAC 2 cut(s) 110, 112
MnlI CCTC 1 cut(s) 121
MslI CAYNNNNRTG 1 cut(s) 324
MspR9I CCNGG 3 cut(s) 6, 54, 354
MvaI CCWGG 3 cut(s) 6, 54, 354
NlaIII CATG 3 cut(s) 47, 128, 323
NspI RCATGY 1 cut(s) 323
PaeI GCATGC 1 cut(s) 323
PfeI GAWTC 1 cut(s) 227
PfoI TCCNGGA 1 cut(s) 352
Psp6I CCWGG 3 cut(s) 4, 52, 352
PspGI CCWGG 3 cut(s) 4, 52, 352
PstNI CAGNNNCTG 1 cut(s) 77
RseI CAYNNNNRTG 1 cut(s) 324
ScrFI CCNGG 3 cut(s) 6, 54, 354
SetI ASST 6 cut(s) 55, 103, 132, 139, 182, 341
SexAI ACCWGGT 1 cut(s) 52
SfaNI GCATC 1 cut(s) 13
SmiMI CAYNNNNRTG 1 cut(s) 324
SmlI CTYRAG 1 cut(s) 148
SmoI CTYRAG 1 cut(s) 148
SphI GCATGC 1 cut(s) 323
StyD4I CCNGG 3 cut(s) 4, 52, 352
TaaI ACNGT 1 cut(s) 64
TfiI GAWTC 1 cut(s) 227
TscAI CASTG 1 cut(s) 265
TspDTI ATGAA 1 cut(s) 32
TspRI CASTG 1 cut(s) 265
XceI RCATGY 1 cut(s) 323
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.