Rh6CG518700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0002860
Physical Location & Seq
Reverse (-)
67541957 .. 67542241
285 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG518700.1

Sequence Viewer

Length: 285 bp
ATGAGCCTCAGCACTAACGTGCATCGTAGAATTTTCGACTACTTCAGCATTTATTTCGTCTCTGTTTGGACTGGACCATGCCTCATTGCGCTAACATTCTCTGCAGAGGCCCATTCCATTGCGCTAACATTCTCTGCAGAGGCCCAATCCATTACACTCAAACTGCGTCGTTTCGATCTGGACTGCCAAGTGTGTACAAAAGTACGTACTCCAAAGTCCAAAGCAAAAGAGCTTCGCTTCGGAGTTTGGACTGTTGGCTTCGCCGGAGCATCACGGCCAGTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

94

Amino Acids

10.55

Weight (kDa)

9.73

Isoelectric Point (pI)

38.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 275
AcsI RAATTY 1 cut(s) 30
AcuI CTGAAG 1 cut(s) 28
AfaI GTAC 3 cut(s) 196, 204, 208
AleI CACNNNNGTG 1 cut(s) 17
AluBI AGCT 1 cut(s) 232
AluI AGCT 1 cut(s) 232
Alw26I GTCTC 1 cut(s) 64
AoxI GGCC 3 cut(s) 108, 141, 275
ApoI RAATTY 1 cut(s) 30
AspLEI GCGC 2 cut(s) 91, 124
AspS9I GGNCC 3 cut(s) 74, 109, 142
AvaII GGWCC 1 cut(s) 74
BbvCI CCTCAGC 1 cut(s) 8
BcgI CGANNNNNNTGC 2 cut(s) 37, 71
BcoDI GTCTC 1 cut(s) 64
BfmI CTRYAG 2 cut(s) 102, 135
Bme18I GGWCC 1 cut(s) 74
BmgT120I GGNCC 3 cut(s) 74, 109, 142
BmsI GCATC 2 cut(s) 31, 278
Bpu10I CCTNAGC 1 cut(s) 8
BsaAI YACGTR 1 cut(s) 206
Bse1I ACTGG 2 cut(s) 76, 278
Bse3DI GCAATG 2 cut(s) 84, 117
BseMI GCAATG 2 cut(s) 84, 117
BseMII CTCAG 1 cut(s) 22
BseNI ACTGG 2 cut(s) 76, 278
BshFI GGCC 3 cut(s) 110, 143, 277
BsiSI CCGG 1 cut(s) 264
BsmAI GTCTC 1 cut(s) 64
BsmBI CGTCTC 1 cut(s) 64
BsnI GGCC 3 cut(s) 110, 143, 277
Bsp1407I TGTACA 1 cut(s) 194
Bsp143I GATC 1 cut(s) 175
BspANI GGCC 3 cut(s) 110, 143, 277
BspCNI CTCAG 1 cut(s) 21
BspMAI CTGCAG 2 cut(s) 106, 139
BsrDI GCAATG 2 cut(s) 84, 117
BsrGI TGTACA 1 cut(s) 194
BsrI ACTGG 2 cut(s) 76, 278
BssMI GATC 1 cut(s) 175
Bst4CI ACNGT 1 cut(s) 253
BstAUI TGTACA 1 cut(s) 194
BstBAI YACGTR 1 cut(s) 206
BstDEI CTNAG 1 cut(s) 8
BstHHI GCGC 2 cut(s) 91, 124
BstKTI GATC 1 cut(s) 178
BstMAI GTCTC 1 cut(s) 64
BstMBI GATC 1 cut(s) 175
BstSFI CTRYAG 2 cut(s) 102, 135
BstSNI TACGTA 1 cut(s) 206
BsuRI GGCC 3 cut(s) 110, 143, 277
CfoI GCGC 2 cut(s) 91, 124
Cfr13I GGNCC 3 cut(s) 74, 109, 142
CseI GACGC 1 cut(s) 155
Csp6I GTAC 3 cut(s) 195, 203, 207
CviAII CATG 1 cut(s) 78
CviJI RGCY 6 cut(s) 6, 110, 143, 232, 258, 277
CviKI_1 RGCY 6 cut(s) 6, 110, 143, 232, 258, 277
CviQI GTAC 3 cut(s) 195, 203, 207
DdeI CTNAG 1 cut(s) 8
DpnI GATC 1 cut(s) 177
DpnII GATC 1 cut(s) 175
EaeI YGGCCR 1 cut(s) 275
Eco105I TACGTA 1 cut(s) 206
Eco47I GGWCC 1 cut(s) 74
Eco57I CTGAAG 1 cut(s) 28
Esp3I CGTCTC 1 cut(s) 64
FaeI CATG 1 cut(s) 81
FaiI YATR 1 cut(s) 79
FatI CATG 1 cut(s) 77
GlaI GCGC 2 cut(s) 90, 123
HaeIII GGCC 3 cut(s) 110, 143, 277
HapII CCGG 1 cut(s) 264
HgaI GACGC 1 cut(s) 155
HhaI GCGC 2 cut(s) 91, 124
Hin1II CATG 1 cut(s) 81
Hin6I GCGC 2 cut(s) 89, 122
HinP1I GCGC 2 cut(s) 89, 122
HpaII CCGG 1 cut(s) 264
Hpy166II GTNNAC 1 cut(s) 195
Hpy188I TCNGA 1 cut(s) 242
Hpy188III TCNNGA 1 cut(s) 179
Hpy8I GTNNAC 1 cut(s) 195
Hpy99I CGWCG 1 cut(s) 171
HpyCH4III ACNGT 1 cut(s) 253
HpyCH4IV ACGT 2 cut(s) 18, 205
HpyCH4V TGCA 3 cut(s) 22, 104, 137
HpyF3I CTNAG 1 cut(s) 8
HpySE526I ACGT 2 cut(s) 18, 205
Hsp92II CATG 1 cut(s) 81
HspAI GCGC 2 cut(s) 89, 122
Kzo9I GATC 1 cut(s) 175
LmnI GCTCC 1 cut(s) 266
LpnPI CCDG 3 cut(s) 57, 164, 277
LweI GCATC 2 cut(s) 31, 278
MaeII ACGT 2 cut(s) 18, 205
MalI GATC 1 cut(s) 177
MboI GATC 1 cut(s) 175
MluCI AATT 1 cut(s) 30
MnlI CCTC 4 cut(s) 17, 92, 100, 133
MslI CAYNNNNRTG 1 cut(s) 17
MspI CCGG 1 cut(s) 264
NdeII GATC 1 cut(s) 175
NlaIII CATG 1 cut(s) 81
OliI CACNNNNGTG 1 cut(s) 17
Ppu21I YACGTR 1 cut(s) 206
PspPI GGNCC 3 cut(s) 74, 109, 142
PstI CTGCAG 2 cut(s) 106, 139
RsaI GTAC 3 cut(s) 196, 204, 208
RsaNI GTAC 3 cut(s) 195, 203, 207
RseI CAYNNNNRTG 1 cut(s) 17
Sau3AI GATC 1 cut(s) 175
Sau96I GGNCC 3 cut(s) 74, 109, 142
SetI ASST 3 cut(s) 21, 208, 234
SfaNI GCATC 2 cut(s) 31, 278
SfcI CTRYAG 2 cut(s) 102, 135
SgeI CNNG 6 cut(s) 31, 84, 90, 191, 200, 276
SinI GGWCC 1 cut(s) 74
SmiMI CAYNNNNRTG 1 cut(s) 17
SnaBI TACGTA 1 cut(s) 206
Sse9I AATT 1 cut(s) 30
TaaI ACNGT 1 cut(s) 253
TaiI ACGT 2 cut(s) 21, 208
TaqI TCGA 2 cut(s) 36, 174
TasI AATT 1 cut(s) 30
TatI WGTACW 1 cut(s) 194
VpaK11BI GGWCC 1 cut(s) 74
XapI RAATTY 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.