Rh1BG126500

RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Forward (+)
21342229 .. 21345330
3102 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG126500.1

Sequence Viewer

Length: 153 bp
ATGGCAGGGGCTGGTTTTCCATCTCCTTTACAAGCTCAGACTTTACTAAACCAAAGACATAAGGTCGGAGCTGGCATTGGCTCAAGTGTTTCTACTGACTTCAGTAGAGAAAGGTCTGTGCCTTCAAGGAGTGGTGATGTCTCCCAGTCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

50

Amino Acids

5.16

Weight (kDa)

10.67

Isoelectric Point (pI)

81.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 85
AgsI TTSAA 1 cut(s) 126
AhdI GACNNNNNGTC 1 cut(s) 62
AluBI AGCT 2 cut(s) 35, 71
AluI AGCT 2 cut(s) 35, 71
Alw26I GTCTC 1 cut(s) 145
AlwNI CAGNNNCTG 1 cut(s) 11
AsuHPI GGTGA 1 cut(s) 146
BccI CCATC 1 cut(s) 28
BcoDI GTCTC 1 cut(s) 145
BmeRI GACNNNNNGTC 1 cut(s) 62
BmrI ACTGGG 1 cut(s) 139
BmuI ACTGGG 1 cut(s) 139
BpuEI CTTGAG 1 cut(s) 67
Bse1I ACTGG 1 cut(s) 145
BseMII CTCAG 1 cut(s) 50
BseNI ACTGG 1 cut(s) 145
BsmAI GTCTC 1 cut(s) 145
BspCNI CTCAG 1 cut(s) 49
BsrI ACTGG 1 cut(s) 145
BstC8I GCNNGC 1 cut(s) 73
BstDEI CTNAG 1 cut(s) 36
BstMAI GTCTC 1 cut(s) 145
Cac8I GCNNGC 1 cut(s) 73
CaiI CAGNNNCTG 1 cut(s) 11
CviJI RGCY 4 cut(s) 11, 35, 71, 81
CviKI_1 RGCY 4 cut(s) 11, 35, 71, 81
DdeI CTNAG 1 cut(s) 36
DriI GACNNNNNGTC 1 cut(s) 62
Eam1105I GACNNNNNGTC 1 cut(s) 62
Eco57I CTGAAG 1 cut(s) 85
FaiI YATR 1 cut(s) 60
HphI GGTGA 1 cut(s) 146
Hpy188I TCNGA 2 cut(s) 39, 68
HpyAV CCTTC 1 cut(s) 132
HpyF3I CTNAG 1 cut(s) 36
LmnI GCTCC 1 cut(s) 68
LpnPI CCDG 1 cut(s) 57
MmeI TCCRAC 1 cut(s) 46
PstNI CAGNNNCTG 1 cut(s) 11
SetI ASST 4 cut(s) 37, 66, 73, 116
SgeI CNNG 6 cut(s) 18, 24, 44, 84, 96, 138
SmlI CTYRAG 1 cut(s) 82
SmoI CTYRAG 1 cut(s) 82
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.