Rh6BG397600

RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Forward (+)
62561857 .. 62562138
282 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG397600.1

Sequence Viewer

Length: 282 bp
ATGAAAGAATTGTGTTGTTCTGTCTGTTTGCATATGAGGTCAATGACGCCTGGGGTTTATGGTGTAGATGCTGTGAGTATTAGTGTTCGTGGTGAACCTGGTCTTACTGTAACAGCAGGGGCTGGTTTTCCATCTCCTTTACAAGCTCAGACTTTACTAAACCAAAGACATGAGGTCGGAGCTGGCATTGGCTCAAGTGTTTCTACTGACTTCTTTAGAGAAAGGTTTGTGCCTTCGAGGAGTGGTGATGGTCTCCCAGTCCTGAAAGGGGAATCAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

93

Amino Acids

9.75

Weight (kDa)

6.7

Isoelectric Point (pI)

37.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcyI GRCGYC 1 cut(s) 47
AfiI CCNNNNNNNGG 1 cut(s) 268
AhdI GACNNNNNGTC 1 cut(s) 173
AjnI CCWGG 2 cut(s) 49, 97
AluBI AGCT 2 cut(s) 146, 182
AluI AGCT 2 cut(s) 146, 182
Alw26I GTCTC 1 cut(s) 257
AlwNI CAGNNNCTG 1 cut(s) 122
AsuHPI GGTGA 2 cut(s) 104, 257
BccI CCATC 2 cut(s) 139, 242
BciT130I CCWGG 2 cut(s) 51, 99
BcoDI GTCTC 1 cut(s) 257
Bme1390I CCNGG 2 cut(s) 51, 99
BmeRI GACNNNNNGTC 1 cut(s) 173
BmrFI CCNGG 2 cut(s) 51, 99
BmrI ACTGGG 1 cut(s) 251
BmsI GCATC 1 cut(s) 58
BmuI ACTGGG 1 cut(s) 251
BpuEI CTTGAG 1 cut(s) 178
BsaHI GRCGYC 1 cut(s) 47
BsaI GGTCTC 1 cut(s) 257
BsaJI CCNNGG 1 cut(s) 50
Bsc4I CCNNNNNNNGG 1 cut(s) 268
Bse1I ACTGG 1 cut(s) 257
BseBI CCWGG 2 cut(s) 51, 99
BseDI CCNNGG 1 cut(s) 50
BseLI CCNNNNNNNGG 1 cut(s) 268
BseMII CTCAG 1 cut(s) 161
BseNI ACTGG 1 cut(s) 257
BseRI GAGGAG 1 cut(s) 253
BslI CCNNNNNNNGG 1 cut(s) 268
BsmAI GTCTC 1 cut(s) 257
Bso31I GGTCTC 1 cut(s) 257
BspCNI CTCAG 1 cut(s) 160
BspTNI GGTCTC 1 cut(s) 257
BsrI ACTGG 1 cut(s) 257
BssECI CCNNGG 1 cut(s) 50
BssNI GRCGYC 1 cut(s) 47
Bst2UI CCWGG 2 cut(s) 51, 99
Bst4CI ACNGT 1 cut(s) 109
BstACI GRCGYC 1 cut(s) 47
BstC8I GCNNGC 1 cut(s) 184
BstDEI CTNAG 1 cut(s) 147
BstMAI GTCTC 1 cut(s) 257
BstNI CCWGG 2 cut(s) 51, 99
BstSCI CCNGG 2 cut(s) 49, 97
Cac8I GCNNGC 1 cut(s) 184
CaiI CAGNNNCTG 1 cut(s) 122
CseI GACGC 1 cut(s) 55
CsiI ACCWGGT 1 cut(s) 97
CviAII CATG 1 cut(s) 170
CviJI RGCY 4 cut(s) 122, 146, 182, 192
CviKI_1 RGCY 4 cut(s) 122, 146, 182, 192
DdeI CTNAG 1 cut(s) 147
DriI GACNNNNNGTC 1 cut(s) 173
Eam1105I GACNNNNNGTC 1 cut(s) 173
Eco31I GGTCTC 1 cut(s) 257
EcoRII CCWGG 2 cut(s) 49, 97
FaeI CATG 1 cut(s) 173
FaiI YATR 4 cut(s) 33, 35, 60, 171
FatI CATG 1 cut(s) 169
FauNDI CATATG 1 cut(s) 33
HgaI GACGC 1 cut(s) 55
Hin1I GRCGYC 1 cut(s) 47
Hin1II CATG 1 cut(s) 173
HinfI GANTC 1 cut(s) 272
HphI GGTGA 2 cut(s) 104, 257
Hpy166II GTNNAC 1 cut(s) 95
Hpy188I TCNGA 2 cut(s) 150, 179
Hpy188III TCNNGA 1 cut(s) 262
Hpy8I GTNNAC 1 cut(s) 95
HpyAV CCTTC 1 cut(s) 243
HpyCH4III ACNGT 1 cut(s) 109
HpyCH4V TGCA 1 cut(s) 31
HpyF3I CTNAG 1 cut(s) 147
Hsp92I GRCGYC 1 cut(s) 47
Hsp92II CATG 1 cut(s) 173
LmnI GCTCC 1 cut(s) 179
LpnPI CCDG 9 cut(s) 36, 63, 84, 102, 108, 111, 168, 270, 275
LweI GCATC 1 cut(s) 58
MabI ACCWGGT 1 cut(s) 97
MaeIII GTNAC 1 cut(s) 109
MluCI AATT 2 cut(s) 8, 277
MmeI TCCRAC 1 cut(s) 157
MnlI CCTC 3 cut(s) 30, 166, 231
MseI TTAA 1 cut(s) 280
MspR9I CCNGG 2 cut(s) 51, 99
MvaI CCWGG 2 cut(s) 51, 99
NdeI CATATG 1 cut(s) 33
NlaIII CATG 1 cut(s) 173
PfeI GAWTC 1 cut(s) 272
Psp6I CCWGG 2 cut(s) 49, 97
PspGI CCWGG 2 cut(s) 49, 97
PstNI CAGNNNCTG 1 cut(s) 122
SaqAI TTAA 1 cut(s) 280
ScrFI CCNGG 2 cut(s) 51, 99
SetI ASST 6 cut(s) 41, 100, 148, 177, 184, 227
SexAI ACCWGGT 1 cut(s) 97
SfaNI GCATC 1 cut(s) 58
SmlI CTYRAG 1 cut(s) 193
SmoI CTYRAG 1 cut(s) 193
Sse9I AATT 2 cut(s) 8, 277
StyD4I CCNGG 2 cut(s) 49, 97
TaaI ACNGT 1 cut(s) 109
TaqI TCGA 1 cut(s) 236
TasI AATT 2 cut(s) 8, 277
TfiI GAWTC 1 cut(s) 272
Tru1I TTAA 1 cut(s) 280
Tru9I TTAA 1 cut(s) 280
TspDTI ATGAA 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.