Rmu_ssc0000472.1_g000017

RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000472.1
Physical Location & Seq
Forward (+)
86930 .. 87845
916 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000472.1_g000017.1.cds

Sequence Viewer

Length: 360 bp
atgggcacaagcagggttgatgaggatgctgaacctaaatcgttggggtctgtgtcgtatggtgtagatgatagtgtgggtagtagagttcgttctgattcgggtgttgggatgaggtcaatgacgcctggggtttatggtgtagatgctgtgagtattagtgttcgtggtgaacctggtcttactgtaacagcaggggctggttttccatctcctttacaagctcagactttactaaaccaaagacatgaggtcggagctggcattggctcaagtgtttctactgacttctttagagaaaggtttgtgccttcgaggagtggtgatggtctcccagtcctgaaaggggaatcaaattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

119

Amino Acids

12.25

Weight (kDa)

5.01

Isoelectric Point (pI)

37.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcyI GRCGYC 1 cut(s) 125
AfiI CCNNNNNNNGG 1 cut(s) 346
AhdI GACNNNNNGTC 1 cut(s) 251
AjnI CCWGG 2 cut(s) 127, 175
AluBI AGCT 2 cut(s) 224, 260
AluI AGCT 2 cut(s) 224, 260
Alw26I GTCTC 1 cut(s) 335
AlwNI CAGNNNCTG 1 cut(s) 200
AsuHPI GGTGA 2 cut(s) 182, 335
BaeGI GKGCMC 1 cut(s) 8
BccI CCATC 2 cut(s) 217, 320
BciT130I CCWGG 2 cut(s) 129, 177
BcoDI GTCTC 1 cut(s) 335
Bme1390I CCNGG 2 cut(s) 129, 177
BmeRI GACNNNNNGTC 1 cut(s) 251
BmrFI CCNGG 2 cut(s) 129, 177
BmrI ACTGGG 1 cut(s) 329
BmsI GCATC 2 cut(s) 16, 136
BmuI ACTGGG 1 cut(s) 329
BpuEI CTTGAG 1 cut(s) 256
BsaHI GRCGYC 1 cut(s) 125
BsaI GGTCTC 1 cut(s) 335
BsaJI CCNNGG 1 cut(s) 128
Bsc4I CCNNNNNNNGG 1 cut(s) 346
Bse1I ACTGG 1 cut(s) 335
BseBI CCWGG 2 cut(s) 129, 177
BseDI CCNNGG 1 cut(s) 128
BseGI GGATG 2 cut(s) 31, 117
BseLI CCNNNNNNNGG 1 cut(s) 346
BseMII CTCAG 1 cut(s) 239
BseNI ACTGG 1 cut(s) 335
BseRI GAGGAG 1 cut(s) 331
BseSI GKGCMC 1 cut(s) 8
BslI CCNNNNNNNGG 1 cut(s) 346
BsmAI GTCTC 1 cut(s) 335
Bso31I GGTCTC 1 cut(s) 335
Bsp1286I GDGCHC 1 cut(s) 8
BspCNI CTCAG 1 cut(s) 238
BspTNI GGTCTC 1 cut(s) 335
BsrI ACTGG 1 cut(s) 335
BssECI CCNNGG 1 cut(s) 128
BssNI GRCGYC 1 cut(s) 125
Bst2UI CCWGG 2 cut(s) 129, 177
Bst4CI ACNGT 1 cut(s) 187
BstACI GRCGYC 1 cut(s) 125
BstC8I GCNNGC 1 cut(s) 262
BstDEI CTNAG 1 cut(s) 225
BstF5I GGATG 2 cut(s) 31, 117
BstMAI GTCTC 1 cut(s) 335
BstNI CCWGG 2 cut(s) 129, 177
BstSCI CCNGG 2 cut(s) 127, 175
BstSLI GKGCMC 1 cut(s) 8
BtsCI GGATG 2 cut(s) 31, 117
Cac8I GCNNGC 1 cut(s) 262
CaiI CAGNNNCTG 1 cut(s) 200
CseI GACGC 1 cut(s) 133
CsiI ACCWGGT 1 cut(s) 175
CviAII CATG 1 cut(s) 248
CviJI RGCY 4 cut(s) 200, 224, 260, 270
CviKI_1 RGCY 4 cut(s) 200, 224, 260, 270
DdeI CTNAG 1 cut(s) 225
DriI GACNNNNNGTC 1 cut(s) 251
Eam1105I GACNNNNNGTC 1 cut(s) 251
Eco31I GGTCTC 1 cut(s) 335
EcoRII CCWGG 2 cut(s) 127, 175
FaeI CATG 1 cut(s) 251
FaiI YATR 3 cut(s) 60, 138, 249
FatI CATG 1 cut(s) 247
FokI GGATG 2 cut(s) 38, 124
HgaI GACGC 1 cut(s) 133
Hin1I GRCGYC 1 cut(s) 125
Hin1II CATG 1 cut(s) 251
HinfI GANTC 2 cut(s) 98, 350
HphI GGTGA 2 cut(s) 182, 335
Hpy166II GTNNAC 1 cut(s) 173
Hpy188I TCNGA 3 cut(s) 97, 228, 257
Hpy188III TCNNGA 1 cut(s) 340
Hpy8I GTNNAC 1 cut(s) 173
HpyAV CCTTC 1 cut(s) 321
HpyCH4III ACNGT 1 cut(s) 187
HpyF3I CTNAG 1 cut(s) 225
Hsp92I GRCGYC 1 cut(s) 125
Hsp92II CATG 1 cut(s) 251
LmnI GCTCC 1 cut(s) 257
LpnPI CCDG 9 cut(s) 114, 141, 162, 180, 186, 189, 246, 348, 353
LweI GCATC 2 cut(s) 16, 136
MabI ACCWGGT 1 cut(s) 175
MaeIII GTNAC 1 cut(s) 187
MhlI GDGCHC 1 cut(s) 8
MluCI AATT 1 cut(s) 355
MmeI TCCRAC 1 cut(s) 235
MnlI CCTC 4 cut(s) 16, 108, 244, 309
MseI TTAA 1 cut(s) 358
MspR9I CCNGG 2 cut(s) 129, 177
MvaI CCWGG 2 cut(s) 129, 177
NlaIII CATG 1 cut(s) 251
PfeI GAWTC 2 cut(s) 98, 350
Psp6I CCWGG 2 cut(s) 127, 175
PspGI CCWGG 2 cut(s) 127, 175
PsrI GAACNNNNNNTAC 2 cut(s) 76, 108
PstNI CAGNNNCTG 1 cut(s) 200
SaqAI TTAA 1 cut(s) 358
ScrFI CCNGG 2 cut(s) 129, 177
SduI GDGCHC 1 cut(s) 8
SetI ASST 7 cut(s) 37, 119, 178, 226, 255, 262, 305
SexAI ACCWGGT 1 cut(s) 175
SfaNI GCATC 2 cut(s) 16, 136
SmlI CTYRAG 1 cut(s) 271
SmoI CTYRAG 1 cut(s) 271
Sse9I AATT 1 cut(s) 355
StyD4I CCNGG 2 cut(s) 127, 175
TaaI ACNGT 1 cut(s) 187
TaqI TCGA 1 cut(s) 314
TasI AATT 1 cut(s) 355
TfiI GAWTC 2 cut(s) 98, 350
Tru1I TTAA 1 cut(s) 358
Tru9I TTAA 1 cut(s) 358
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.