Rh6BG397500

RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Forward (+)
62555423 .. 62561802
6380 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG397500.1

Sequence Viewer

Length: 219 bp
ATGTTTAAGAAGAATGGTTTGGAGAAAGACTATCCATTCAAATCAAGCCCTTATGAGGAAACAATTTATGCAGAGAAATCGTTGGGGTCTGTGCCGTATGGTGTAGATGATAGTGTGGGTAGTAGAGTTCGTTCTGATTCGGGTGTTGGGGTGACAGCAGGGTCTAGCCTATATGATCCTTTGGAAGATACTGAAGCCAGAGACAGGATATTGCGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

7.94

Weight (kDa)

4.79

Isoelectric Point (pI)

47.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 160
AciI CCGC 1 cut(s) 214
AclWI GGATC 1 cut(s) 170
AcuI CTGAAG 1 cut(s) 213
AfiI CCNNNNNNNGG 2 cut(s) 55, 204
AgsI TTSAA 1 cut(s) 40
AjuI GAANNNNNNNTTGG 1 cut(s) 34
Alw26I GTCTC 1 cut(s) 195
AlwI GGATC 1 cut(s) 170
AsuHPI GGTGA 1 cut(s) 163
BceAI ACGGC 1 cut(s) 79
BcgI CGANNNNNNTGC 2 cut(s) 60, 94
BcoDI GTCTC 1 cut(s) 195
BfaI CTAG 1 cut(s) 165
Bsc4I CCNNNNNNNGG 2 cut(s) 55, 204
BseLI CCNNNNNNNGG 2 cut(s) 55, 204
BslI CCNNNNNNNGG 2 cut(s) 55, 204
BsmAI GTCTC 1 cut(s) 195
Bsp143I GATC 1 cut(s) 175
BspACI CCGC 1 cut(s) 214
BspPI GGATC 1 cut(s) 170
BssMI GATC 1 cut(s) 175
BstKTI GATC 1 cut(s) 178
BstMAI GTCTC 1 cut(s) 195
BstMBI GATC 1 cut(s) 175
CviJI RGCY 3 cut(s) 48, 168, 197
CviKI_1 RGCY 3 cut(s) 48, 168, 197
DpnI GATC 1 cut(s) 177
DpnII GATC 1 cut(s) 175
DrdI GACNNNNNNGTC 1 cut(s) 160
DseDI GACNNNNNNGTC 1 cut(s) 160
Eco57I CTGAAG 1 cut(s) 213
FaiI YATR 5 cut(s) 54, 69, 99, 172, 174
FspBI CTAG 1 cut(s) 165
HinfI GANTC 1 cut(s) 137
HphI GGTGA 1 cut(s) 163
Hpy188I TCNGA 1 cut(s) 136
HpyCH4V TGCA 1 cut(s) 71
Kzo9I GATC 1 cut(s) 175
LpnPI CCDG 3 cut(s) 144, 190, 211
MaeI CTAG 1 cut(s) 165
MaeIII GTNAC 1 cut(s) 151
MalI GATC 1 cut(s) 177
MboI GATC 1 cut(s) 175
MboII GAAGA 2 cut(s) 22, 197
MluCI AATT 1 cut(s) 63
MnlI CCTC 1 cut(s) 49
MseI TTAA 1 cut(s) 6
NdeII GATC 1 cut(s) 175
NmuCI GTSAC 1 cut(s) 151
PfeI GAWTC 1 cut(s) 137
PsrI GAACNNNNNNTAC 2 cut(s) 115, 147
SaqAI TTAA 1 cut(s) 6
Sau3AI GATC 1 cut(s) 175
SgeI CNNG 5 cut(s) 57, 153, 171, 177, 210
Sse9I AATT 1 cut(s) 63
SsiI CCGC 1 cut(s) 214
SspMI CTAG 1 cut(s) 165
TasI AATT 1 cut(s) 63
TfiI GAWTC 1 cut(s) 137
Tru1I TTAA 1 cut(s) 6
Tru9I TTAA 1 cut(s) 6
TseFI GTSAC 1 cut(s) 151
Tsp45I GTSAC 1 cut(s) 151
XspI CTAG 1 cut(s) 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.