Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003219.1

Orthogroup ID

OG0003693

Physical Location & Seq

Genomic Coordinates Reverse (-)

83457 .. 85147

Gene Structure 1691 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003219.1_g000018.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 378 bp

atgatattcagcgactcacaacttgtagtcgagcaagtcaacaacgagtatatagagaatgatgaaaagatggaggcatttaaaaaaatggctcaaagcaggatgaccgagtttgatagatcaagcctgaccaagacaccaagagaacataatacgcaggcagataggaagagctgcgcatactcagggctcttcatgatcaggccccatactgagattgaacagctcaaagcggacgttaagccggaaaaagagggttatgagcatgcagttgcggaagttaggaaccttcaacggagagaaatatccatgacatttgagcagcagccttggatgagaggtatcgtctcaagatccatgcttaccgtgaaacgataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_1 RVT_3 Retrotrans_gag

Protein Analysis

125

Amino Acids

14.76

Weight (kDa)

6.85

Isoelectric Point (pI)

62.94

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003693)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g05721
rosa_chinensis	RchiOBHm_Chr1g0343511
rosa_laevigata	RLG00000019160 RLG00000019378 RLG00000019379 RLG00000022496 RLG00000022772 RLG00000022774 RLG00000029386 RLG00000029511 RLG00000029513 RLG00000029661
rosa_multiflora	Rmu_sc0000335.1_g000029 Rmu_sc0003219.1_g000018 Rmu_sc0004118.1_g000007 Rmu_sc0004413.1_g000011 Rmu_sc0006695.1_g000004
rosa_roxburghii	Rroxscaffold_2G00113320 Rroxscaffold_2G00113360 Rroxscaffold_3G00235530 Rroxscaffold_3G00235540 Rroxscaffold_4G00314360 Rroxscaffold_5G00335830 Rroxscaffold_5G00349870 Rroxscaffold_6G00389460
rosa_samantha	Rh2AG346000 Rh2AG346100 Rh2AG346400 Rh2AG346500 Rh2CG332600 Rh3AG327300 Rh3CG360300 Rh3DG363500 Rh7BG352700 Rh7DG378200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	178
AciI	CCGC	2 cut(s)	233, 275
AclWI	GGATC	1 cut(s)	348
AgsI	TTSAA	2 cut(s)	221, 293
AluBI	AGCT	2 cut(s)	174, 226
AluI	AGCT	2 cut(s)	174, 226
Alw26I	GTCTC	1 cut(s)	352
AlwI	GGATC	1 cut(s)	348
AoxI	GGCC	1 cut(s)	203
ApeKI	GCWGC	3 cut(s)	174, 322, 325
AspLEI	GCGC	1 cut(s)	179
AspS9I	GGNCC	1 cut(s)	204
BanII	GRGCYC	1 cut(s)	192
BbvI	GCAGC	3 cut(s)	161, 334, 337
BccI	CCATC	1 cut(s)	64
BclI	TGATCA	1 cut(s)	198
BcoDI	GTCTC	1 cut(s)	352
BisI	GCNGC	3 cut(s)	175, 323, 326
BlsI	GCNGC	3 cut(s)	176, 324, 327
BmgT120I	GGNCC	1 cut(s)	204
BmiI	GGNNCC	2 cut(s)	206, 287
BpuEI	CTTGAG	1 cut(s)	334
BsaJI	CCNNGG	1 cut(s)	329
BseDI	CCNNGG	1 cut(s)	329
BseGI	GGATG	2 cut(s)	108, 339
BseMII	CTCAG	2 cut(s)	198, 204
BseXI	GCAGC	3 cut(s)	161, 334, 337
BshFI	GGCC	1 cut(s)	205
BsiSI	CCGG	1 cut(s)	245
BsmAI	GTCTC	1 cut(s)	352
BsmBI	CGTCTC	1 cut(s)	352
BsnI	GGCC	1 cut(s)	205
Bsp1286I	GDGCHC	1 cut(s)	192
Bsp143I	GATC	3 cut(s)	119, 198, 353
BspACI	CCGC	2 cut(s)	233, 275
BspANI	GGCC	1 cut(s)	205
BspCNI	CTCAG	2 cut(s)	197, 205
BspHI	TCATGA	1 cut(s)	195
BspLI	GGNNCC	2 cut(s)	206, 287
BspPI	GGATC	1 cut(s)	348
BspQI	GCTCTTC	2 cut(s)	164, 197
BssECI	CCNNGG	1 cut(s)	329
BssMI	GATC	3 cut(s)	119, 198, 353
BssT1I	CCWWGG	1 cut(s)	329
Bst4CI	ACNGT	1 cut(s)	367
Bst6I	CTCTTC	2 cut(s)	164, 197
BstC8I	GCNNGC	2 cut(s)	159, 267
BstDEI	CTNAG	2 cut(s)	184, 213
BstF5I	GGATG	2 cut(s)	108, 339
BstHHI	GCGC	1 cut(s)	179
BstKTI	GATC	3 cut(s)	122, 201, 356
BstMAI	GTCTC	1 cut(s)	352
BstMBI	GATC	3 cut(s)	119, 198, 353
BstNSI	RCATGY	1 cut(s)	269
BstV1I	GCAGC	3 cut(s)	161, 334, 337
BstX2I	RGATCY	1 cut(s)	353
BstYI	RGATCY	1 cut(s)	353
BsuRI	GGCC	1 cut(s)	205
BtsCI	GGATG	2 cut(s)	108, 339
Cac8I	GCNNGC	2 cut(s)	159, 267
CciI	TCATGA	1 cut(s)	195
CfoI	GCGC	1 cut(s)	179
Cfr13I	GGNCC	1 cut(s)	204
CviAII	CATG	4 cut(s)	196, 266, 310, 358
CviJI	RGCY	8 cut(s)	92, 126, 174, 190, 205, 226, 244, 328
CviKI_1	RGCY	8 cut(s)	92, 126, 174, 190, 205, 226, 244, 328
DdeI	CTNAG	2 cut(s)	184, 213
DpnI	GATC	3 cut(s)	121, 200, 355
DpnII	GATC	3 cut(s)	119, 198, 353
DraI	TTTAAA	1 cut(s)	82
Eam1104I	CTCTTC	2 cut(s)	164, 197
EarI	CTCTTC	2 cut(s)	164, 197
Eco130I	CCWWGG	1 cut(s)	329
Eco24I	GRGCYC	1 cut(s)	192
EcoO109I	RGGNCCY	1 cut(s)	204
EcoT14I	CCWWGG	1 cut(s)	329
EcoT38I	GRGCYC	1 cut(s)	192
ErhI	CCWWGG	1 cut(s)	329
Esp3I	CGTCTC	1 cut(s)	352
FaeI	CATG	4 cut(s)	199, 269, 313, 361
FatI	CATG	4 cut(s)	195, 265, 309, 357
FbaI	TGATCA	1 cut(s)	198
Fnu4HI	GCNGC	3 cut(s)	175, 323, 326
FokI	GGATG	2 cut(s)	115, 346
FriOI	GRGCYC	1 cut(s)	192
Fsp4HI	GCNGC	3 cut(s)	175, 323, 326
FspI	TGCGCA	1 cut(s)	178
GlaI	GCGC	1 cut(s)	178
GluI	GCNGC	3 cut(s)	175, 323, 326
HaeIII	GGCC	1 cut(s)	205
HapII	CCGG	1 cut(s)	245
HhaI	GCGC	1 cut(s)	179
Hin1II	CATG	4 cut(s)	199, 269, 313, 361
Hin6I	GCGC	1 cut(s)	177
HinP1I	GCGC	1 cut(s)	177
HincII	GTYRAC	1 cut(s)	40
HindII	GTYRAC	1 cut(s)	40
HinfI	GANTC	1 cut(s)	14
HpaII	CCGG	1 cut(s)	245
Hpy166II	GTNNAC	1 cut(s)	40
Hpy188III	TCNNGA	2 cut(s)	196, 351
Hpy8I	GTNNAC	1 cut(s)	40
HpyAV	CCTTC	1 cut(s)	299
HpyCH4III	ACNGT	1 cut(s)	367
HpyCH4IV	ACGT	1 cut(s)	237
HpyCH4V	TGCA	1 cut(s)	269
HpyF3I	CTNAG	2 cut(s)	184, 213
HpySE526I	ACGT	1 cut(s)	237
Hsp92II	CATG	4 cut(s)	199, 269, 313, 361
HspAI	GCGC	1 cut(s)	177
Ksp22I	TGATCA	1 cut(s)	198
Kzo9I	GATC	3 cut(s)	119, 198, 353
LguI	GCTCTTC	2 cut(s)	164, 197
LpnPI	CCDG	6 cut(s)	85, 140, 143, 171, 187, 258
Lsp1109I	GCAGC	3 cut(s)	161, 334, 337
MaeII	ACGT	1 cut(s)	237
MalI	GATC	3 cut(s)	121, 200, 355
MboI	GATC	3 cut(s)	119, 198, 353
MboII	GAAGA	2 cut(s)	181, 184
MflI	RGATCY	1 cut(s)	353
MhlI	GDGCHC	1 cut(s)	192
MlyI	GAGTC	1 cut(s)	8
MnlI	CCTC	3 cut(s)	67, 247, 332
MseI	TTAA	2 cut(s)	81, 240
MspI	CCGG	1 cut(s)	245
NdeII	GATC	3 cut(s)	119, 198, 353
NlaIII	CATG	4 cut(s)	199, 269, 313, 361
NlaIV	GGNNCC	2 cut(s)	206, 287
NsbI	TGCGCA	1 cut(s)	178
NspI	RCATGY	1 cut(s)	269
PaeI	GCATGC	1 cut(s)	269
PagI	TCATGA	1 cut(s)	195
PciSI	GCTCTTC	2 cut(s)	164, 197
PkrI	GCNGC	3 cut(s)	176, 324, 327
PleI	GAGTC	1 cut(s)	8
PpsI	GAGTC	1 cut(s)	8
PspN4I	GGNNCC	2 cut(s)	206, 287
PspPI	GGNCC	1 cut(s)	204
PsuI	RGATCY	1 cut(s)	353
SapI	GCTCTTC	2 cut(s)	164, 197
SaqAI	TTAA	2 cut(s)	81, 240
SatI	GCNGC	3 cut(s)	175, 323, 326
Sau3AI	GATC	3 cut(s)	119, 198, 353
Sau96I	GGNCC	1 cut(s)	204
SchI	GAGTC	1 cut(s)	8
SduI	GDGCHC	1 cut(s)	192
SetI	ASST	5 cut(s)	176, 228, 240, 291, 343
SmlI	CTYRAG	1 cut(s)	349
SmoI	CTYRAG	1 cut(s)	349
SphI	GCATGC	1 cut(s)	269
SsiI	CCGC	2 cut(s)	233, 275
StyI	CCWWGG	1 cut(s)	329
TaaI	ACNGT	1 cut(s)	367
TaiI	ACGT	1 cut(s)	240
TaqI	TCGA	1 cut(s)	30
TaqII	GACCGA	1 cut(s)	122
Tru1I	TTAA	2 cut(s)	81, 240
Tru9I	TTAA	2 cut(s)	81, 240
TseI	GCWGC	3 cut(s)	174, 322, 325
TspDTI	ATGAA	2 cut(s)	78, 184
TspGWI	ACGGA	1 cut(s)	310
XceI	RCATGY	1 cut(s)	269

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.