Rmu_sc0006513.1_g000008

Mediates both low-affinity uptake and efflux of sugar across the membrane

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006513.1
Physical Location & Seq
Forward (+)
36284 .. 37941
1658 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006513.1_g000008.1.cds

Sequence Viewer

Length: 432 bp
atgttgacattctactatgccttcgtcaagacaaactgtttgctgctcatcacgataaattccattggctgcttcatcgaaaccgtgtaccttgttgtgttcatgatatatgcaacaccaaaatccagggcaccaaacgtgttagggtttgcgttcggaattgttcagatgattatgatcctcgtctacaggaagaaaaccaagatagctgtcttgacggaattccgtctaggtgatctgataccaagcgttgctgctccactaaatgatgacatgacagtagcaattgtcattaattctcgatcggaagctggggacgcaaagaagagttctgaaactgatcatgatcagaatccattggagggccggcccaacggcaaggcgaccttggccgctgcctacggcgtcatcttgagaaggggctcaatttaa

Protein Analysis

143

Amino Acids

15.69

Weight (kDa)

9.17

Isoelectric Point (pI)

36.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 130
AccI GTMKAC 1 cut(s) 186
AciI CCGC 1 cut(s) 393
AclWI GGATC 1 cut(s) 172
AcoI YGGCCR 1 cut(s) 390
AcsI RAATTY 2 cut(s) 58, 221
AcyI GRCGYC 1 cut(s) 405
AfaI GTAC 1 cut(s) 89
AfiI CCNNNNNNNGG 1 cut(s) 362
AflIII ACRYGT 1 cut(s) 138
AjnI CCWGG 1 cut(s) 125
AluBI AGCT 2 cut(s) 209, 311
AluI AGCT 2 cut(s) 209, 311
AlwI GGATC 1 cut(s) 172
AoxI GGCC 3 cut(s) 364, 368, 390
ApeKI GCWGC 4 cut(s) 43, 69, 254, 395
ApoI RAATTY 2 cut(s) 58, 221
ArsI GACNNNNNNTTYG 2 cut(s) 22, 54
AseI ATTAAT 1 cut(s) 294
AspS9I GGNCC 2 cut(s) 364, 369
AsuHPI GGTGA 1 cut(s) 245
BaeGI GKGCMC 1 cut(s) 133
BanI GGYRCC 1 cut(s) 130
BanII GRGCYC 1 cut(s) 425
BbvI GCAGC 4 cut(s) 30, 56, 241, 382
BceAI ACGGC 2 cut(s) 391, 418
BciT130I CCWGG 1 cut(s) 127
BclI TGATCA 2 cut(s) 340, 346
BfaI CTAG 1 cut(s) 230
BfmI CTRYAG 1 cut(s) 187
BisI GCNGC 5 cut(s) 44, 70, 255, 393, 396
BlsI GCNGC 5 cut(s) 45, 71, 256, 394, 397
Bme1390I CCNGG 1 cut(s) 127
BmgT120I GGNCC 2 cut(s) 364, 369
BmiI GGNNCC 1 cut(s) 132
BmrFI CCNGG 1 cut(s) 127
BsaBI GATNNNNATC 3 cut(s) 176, 345, 351
BsaHI GRCGYC 1 cut(s) 405
BsaJI CCNNGG 2 cut(s) 126, 387
Bsc4I CCNNNNNNNGG 1 cut(s) 362
Bse118I RCCGGY 1 cut(s) 366
Bse8I GATNNNNATC 3 cut(s) 176, 345, 351
BseBI CCWGG 1 cut(s) 127
BseDI CCNNGG 2 cut(s) 126, 387
BseJI GATNNNNATC 3 cut(s) 176, 345, 351
BseLI CCNNNNNNNGG 1 cut(s) 362
BseSI GKGCMC 1 cut(s) 133
BseXI GCAGC 4 cut(s) 30, 56, 241, 382
BseYI CCCAGC 1 cut(s) 311
Bsh1285I CGRYCG 1 cut(s) 305
BshFI GGCC 3 cut(s) 366, 370, 392
BshNI GGYRCC 1 cut(s) 130
BsiEI CGRYCG 1 cut(s) 305
BsiSI CCGG 1 cut(s) 367
BslFI GGGAC 1 cut(s) 329
BslI CCNNNNNNNGG 1 cut(s) 362
BsmFI GGGAC 1 cut(s) 329
BsnI GGCC 3 cut(s) 366, 370, 392
Bsp1286I GDGCHC 2 cut(s) 133, 425
Bsp143I GATC 5 cut(s) 177, 235, 302, 340, 346
BspACI CCGC 1 cut(s) 393
BspANI GGCC 3 cut(s) 366, 370, 392
BspHI TCATGA 2 cut(s) 102, 343
BspLI GGNNCC 1 cut(s) 132
BspPI GGATC 1 cut(s) 172
BspT107I GGYRCC 1 cut(s) 130
BsrFI RCCGGY 1 cut(s) 366
BssAI RCCGGY 1 cut(s) 366
BssECI CCNNGG 2 cut(s) 126, 387
BssMI GATC 5 cut(s) 177, 235, 302, 340, 346
BssNI GRCGYC 1 cut(s) 405
BssT1I CCWWGG 1 cut(s) 387
Bst2UI CCWGG 1 cut(s) 127
Bst4CI ACNGT 3 cut(s) 38, 85, 280
Bst6I CTCTTC 1 cut(s) 320
BstACI GRCGYC 1 cut(s) 405
BstC8I GCNNGC 1 cut(s) 368
BstKTI GATC 5 cut(s) 180, 238, 305, 343, 349
BstMBI GATC 5 cut(s) 177, 235, 302, 340, 346
BstMCI CGRYCG 1 cut(s) 305
BstMWI GCNNNNNNNGC 2 cut(s) 317, 389
BstNI CCWGG 1 cut(s) 127
BstSCI CCNGG 1 cut(s) 125
BstSFI CTRYAG 1 cut(s) 187
BstSLI GKGCMC 1 cut(s) 133
BstV1I GCAGC 4 cut(s) 30, 56, 241, 382
BsuRI GGCC 3 cut(s) 366, 370, 392
Cac8I GCNNGC 1 cut(s) 368
CciI TCATGA 2 cut(s) 102, 343
Cfr10I RCCGGY 1 cut(s) 366
Cfr13I GGNCC 2 cut(s) 364, 369
CseI GACGC 2 cut(s) 326, 394
Csp6I GTAC 1 cut(s) 88
CviAII CATG 3 cut(s) 103, 274, 344
CviJI RGCY 7 cut(s) 69, 209, 311, 366, 370, 392, 423
CviKI_1 RGCY 7 cut(s) 69, 209, 311, 366, 370, 392, 423
CviQI GTAC 1 cut(s) 88
DpnI GATC 5 cut(s) 179, 237, 304, 342, 348
DpnII GATC 5 cut(s) 177, 235, 302, 340, 346
EaeI YGGCCR 1 cut(s) 390
Eam1104I CTCTTC 1 cut(s) 320
EarI CTCTTC 1 cut(s) 320
Eco130I CCWWGG 1 cut(s) 387
Eco24I GRGCYC 1 cut(s) 425
EcoRI GAATTC 1 cut(s) 221
EcoRII CCWGG 1 cut(s) 125
EcoT14I CCWWGG 1 cut(s) 387
EcoT38I GRGCYC 1 cut(s) 425
ErhI CCWWGG 1 cut(s) 387
FaeI CATG 3 cut(s) 106, 277, 347
FaiI YATR 7 cut(s) 18, 104, 109, 111, 176, 275, 345
FalI AAGNNNNNCTT 2 cut(s) 371, 403
FaqI GGGAC 1 cut(s) 329
FatI CATG 3 cut(s) 102, 273, 343
FbaI TGATCA 2 cut(s) 340, 346
FblI GTMKAC 1 cut(s) 186
Fnu4HI GCNGC 5 cut(s) 44, 70, 255, 393, 396
FriOI GRGCYC 1 cut(s) 425
FseI GGCCGGCC 1 cut(s) 370
Fsp4HI GCNGC 5 cut(s) 44, 70, 255, 393, 396
FspBI CTAG 1 cut(s) 230
GluI GCNGC 5 cut(s) 44, 70, 255, 393, 396
GsaI CCCAGC 1 cut(s) 315
HaeIII GGCC 3 cut(s) 366, 370, 392
HapII CCGG 1 cut(s) 367
HgaI GACGC 2 cut(s) 326, 394
Hin1I GRCGYC 1 cut(s) 405
Hin1II CATG 3 cut(s) 106, 277, 347
HincII GTYRAC 1 cut(s) 6
HindII GTYRAC 1 cut(s) 6
HinfI GANTC 1 cut(s) 352
HpaII CCGG 1 cut(s) 367
HphI GGTGA 1 cut(s) 245
Hpy166II GTNNAC 3 cut(s) 6, 88, 187
Hpy188I TCNGA 6 cut(s) 158, 168, 240, 307, 334, 351
Hpy188III TCNNGA 7 cut(s) 28, 52, 103, 214, 300, 344, 412
Hpy8I GTNNAC 3 cut(s) 6, 88, 187
HpyAV CCTTC 2 cut(s) 31, 411
HpyCH4III ACNGT 3 cut(s) 38, 85, 280
HpyCH4IV ACGT 1 cut(s) 138
HpyCH4V TGCA 1 cut(s) 113
HpyF10VI GCNNNNNNNGC 2 cut(s) 317, 389
HpySE526I ACGT 1 cut(s) 138
Hsp92I GRCGYC 1 cut(s) 405
Hsp92II CATG 3 cut(s) 106, 277, 347
KroI GCCGGC 1 cut(s) 366
KroNI GCCGGC 1 cut(s) 368
Ksp22I TGATCA 2 cut(s) 340, 346
Kzo9I GATC 5 cut(s) 177, 235, 302, 340, 346
LmnI GCTCC 1 cut(s) 262
LpnPI CCDG 5 cut(s) 112, 139, 175, 297, 380
Lsp1109I GCAGC 4 cut(s) 30, 56, 241, 382
MaeI CTAG 1 cut(s) 230
MaeII ACGT 1 cut(s) 138
MalI GATC 5 cut(s) 179, 237, 304, 342, 348
MboI GATC 5 cut(s) 177, 235, 302, 340, 346
MboII GAAGA 2 cut(s) 205, 337
MfeI CAATTG 1 cut(s) 285
MhlI GDGCHC 2 cut(s) 133, 425
MluCI AATT 6 cut(s) 58, 159, 221, 285, 295, 426
MnlI CCTC 2 cut(s) 191, 355
MroNI GCCGGC 1 cut(s) 366
MseI TTAA 2 cut(s) 294, 430
MspA1I CMGCKG 1 cut(s) 395
MspI CCGG 1 cut(s) 367
MspR9I CCNGG 1 cut(s) 127
MunI CAATTG 1 cut(s) 285
MvaI CCWGG 1 cut(s) 127
MwoI GCNNNNNNNGC 2 cut(s) 317, 389
NaeI GCCGGC 1 cut(s) 368
NdeII GATC 5 cut(s) 177, 235, 302, 340, 346
NgoMIV GCCGGC 1 cut(s) 366
NlaIII CATG 3 cut(s) 106, 277, 347
NlaIV GGNNCC 1 cut(s) 132
PagI TCATGA 2 cut(s) 102, 343
PdiI GCCGGC 1 cut(s) 368
PfeI GAWTC 1 cut(s) 352
PkrI GCNGC 5 cut(s) 45, 71, 256, 394, 397
Ple19I CGATCG 1 cut(s) 305
PshBI ATTAAT 1 cut(s) 294
Psp6I CCWGG 1 cut(s) 125
PspFI CCCAGC 1 cut(s) 311
PspGI CCWGG 1 cut(s) 125
PspN4I GGNNCC 1 cut(s) 132
PspPI GGNCC 2 cut(s) 364, 369
PvuI CGATCG 1 cut(s) 305
RigI GGCCGGCC 1 cut(s) 370
RsaI GTAC 1 cut(s) 89
RsaNI GTAC 1 cut(s) 88
SaqAI TTAA 2 cut(s) 294, 430
SatI GCNGC 5 cut(s) 44, 70, 255, 393, 396
Sau3AI GATC 5 cut(s) 177, 235, 302, 340, 346
Sau96I GGNCC 2 cut(s) 364, 369
ScrFI CCNGG 1 cut(s) 127
SduI GDGCHC 2 cut(s) 133, 425
SetI ASST 6 cut(s) 93, 141, 211, 235, 313, 389
SfcI CTRYAG 1 cut(s) 187
SmlI CTYRAG 1 cut(s) 412
SmoI CTYRAG 1 cut(s) 412
Sse9I AATT 6 cut(s) 58, 159, 221, 285, 295, 426
SsiI CCGC 1 cut(s) 393
SspMI CTAG 1 cut(s) 230
StyD4I CCNGG 1 cut(s) 125
StyI CCWWGG 1 cut(s) 387
TaaI ACNGT 3 cut(s) 38, 85, 280
TaiI ACGT 1 cut(s) 141
TaqI TCGA 2 cut(s) 78, 301
TasI AATT 6 cut(s) 58, 159, 221, 285, 295, 426
TauI GCSGC 1 cut(s) 395
TfiI GAWTC 1 cut(s) 352
Tru1I TTAA 2 cut(s) 294, 430
Tru9I TTAA 2 cut(s) 294, 430
TseI GCWGC 4 cut(s) 43, 69, 254, 395
TspDTI ATGAA 2 cut(s) 64, 91
TspGWI ACGGA 2 cut(s) 215, 233
VspI ATTAAT 1 cut(s) 294
XapI RAATTY 2 cut(s) 58, 221
XmiI GTMKAC 1 cut(s) 186
XspI CTAG 1 cut(s) 230
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.