Rmu_sc0006662.1_g000006

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006662.1
Physical Location & Seq
Forward (+)
23452 .. 24169
718 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006662.1_g000006.1.cds

Sequence Viewer

Length: 585 bp
atggtttcaactctaatcgagttcacaacttccttaaatccatcaaactccgaaccccaaattaagctaagcccatcaattcagactgttgtagatgaaatccacaaggcccaatctctctcccttgattcaacaattctaccaaccaatgcaatctcggctccttgcagttcctcaaagagcgtcacgctgctcattcaggtagtgcggttggcacacgatgtcgttttggatttgtttaagagggagttggggttgaagaaagagaagaaagtgatgaaggaggtgaagaatttggtgggagtgattctagggtttataaatgtgtgctgttctagcagggattcgggtcaggaggaacctttgattgattcgagttcgggttggtctttttcgggtttaagttgtgtttggttgaacaaagatgagaattttaggaatttgttaccttcagtgagtgaggaggtgattggtgagcttagtgagagagatggggatgtgagctacttggctggagttgttattgcagaggtttttttgttgagactgtgcttgaattgcaaagctgggacttcaggggattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

194

Amino Acids

21.03

Weight (kDa)

5.02

Isoelectric Point (pI)

46.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 320
AciI CCGC 1 cut(s) 208
AcsI RAATTY 3 cut(s) 292, 430, 439
AcuI CTGAAG 2 cut(s) 435, 558
AgsI TTSAA 5 cut(s) 9, 132, 259, 418, 556
AluBI AGCT 4 cut(s) 67, 478, 504, 566
AluI AGCT 4 cut(s) 67, 478, 504, 566
Alw26I GTCTC 1 cut(s) 538
AoxI GGCC 1 cut(s) 108
ApeKI GCWGC 1 cut(s) 190
ApoI RAATTY 3 cut(s) 292, 430, 439
AspS9I GGNCC 1 cut(s) 109
AsuHPI GGTGA 3 cut(s) 298, 478, 485
BbvI GCAGC 1 cut(s) 177
BccI CCATC 3 cut(s) 49, 82, 485
BcoDI GTCTC 1 cut(s) 538
BfaI CTAG 2 cut(s) 311, 336
BisI GCNGC 1 cut(s) 191
BlpI GCTNAGC 1 cut(s) 68
BlsI GCNGC 1 cut(s) 192
BmgT120I GGNCC 1 cut(s) 109
BmiI GGNNCC 2 cut(s) 162, 360
BpmI CTGGAG 1 cut(s) 534
Bpu1102I GCTNAGC 1 cut(s) 68
BsaXI ACNNNNNCTCC 2 cut(s) 239, 269
BseGI GGATG 1 cut(s) 502
BseRI GAGGAG 1 cut(s) 476
BseXI GCAGC 1 cut(s) 177
BseYI CCCAGC 1 cut(s) 566
BshFI GGCC 1 cut(s) 110
BsmAI GTCTC 1 cut(s) 538
BsnI GGCC 1 cut(s) 110
Bsp1720I GCTNAGC 1 cut(s) 68
BspACI CCGC 1 cut(s) 208
BspANI GGCC 1 cut(s) 110
BspLI GGNNCC 2 cut(s) 162, 360
Bst4CI ACNGT 2 cut(s) 88, 549
BstDEI CTNAG 2 cut(s) 68, 479
BstF5I GGATG 1 cut(s) 502
BstMAI GTCTC 1 cut(s) 538
BstMWI GCNNNNNNNGC 3 cut(s) 158, 336, 558
BstV1I GCAGC 1 cut(s) 177
BsuRI GGCC 1 cut(s) 110
BtsCI GGATG 1 cut(s) 502
BtsIMutI CAGTG 1 cut(s) 459
Cfr13I GGNCC 1 cut(s) 109
CseI GACGC 1 cut(s) 172
CviJI RGCY 8 cut(s) 67, 72, 110, 161, 478, 504, 512, 566
CviKI_1 RGCY 8 cut(s) 67, 72, 110, 161, 478, 504, 512, 566
DdeI CTNAG 2 cut(s) 68, 479
Eco57I CTGAAG 2 cut(s) 435, 558
FaiI YATR 1 cut(s) 320
Fnu4HI GCNGC 1 cut(s) 191
FokI GGATG 1 cut(s) 509
Fsp4HI GCNGC 1 cut(s) 191
FspBI CTAG 2 cut(s) 311, 336
GluI GCNGC 1 cut(s) 191
GsaI CCCAGC 1 cut(s) 570
GsuI CTGGAG 1 cut(s) 534
HaeIII GGCC 1 cut(s) 110
HgaI GACGC 1 cut(s) 172
HinfI GANTC 4 cut(s) 128, 307, 344, 371
HphI GGTGA 3 cut(s) 298, 478, 485
Hpy166II GTNNAC 1 cut(s) 24
Hpy188I TCNGA 2 cut(s) 52, 84
Hpy188III TCNNGA 1 cut(s) 353
Hpy8I GTNNAC 1 cut(s) 24
HpyAV CCTTC 2 cut(s) 274, 459
HpyCH4III ACNGT 2 cut(s) 88, 549
HpyCH4V TGCA 4 cut(s) 152, 168, 527, 561
HpyF10VI GCNNNNNNNGC 3 cut(s) 158, 336, 558
HpyF3I CTNAG 2 cut(s) 68, 479
LmnI GCTCC 1 cut(s) 166
LpnPI CCDG 6 cut(s) 185, 325, 338, 498, 552, 561
Lsp1109I GCAGC 1 cut(s) 177
MaeI CTAG 2 cut(s) 311, 336
MaeIII GTNAC 2 cut(s) 184, 444
MboII GAAGA 3 cut(s) 271, 280, 301
MluCI AATT 7 cut(s) 60, 78, 135, 292, 430, 439, 556
MnlI CCTC 7 cut(s) 184, 237, 277, 349, 454, 457, 523
MseI TTAA 4 cut(s) 35, 63, 240, 401
MwoI GCNNNNNNNGC 3 cut(s) 158, 336, 558
NlaIV GGNNCC 2 cut(s) 162, 360
NmeAIII GCCGAG 1 cut(s) 137
NmuCI GTSAC 1 cut(s) 184
PfeI GAWTC 4 cut(s) 128, 307, 344, 371
PkrI GCNGC 1 cut(s) 192
PsiI TTATAA 1 cut(s) 320
PspFI CCCAGC 1 cut(s) 566
PspN4I GGNNCC 2 cut(s) 162, 360
PspPI GGNCC 1 cut(s) 109
SaqAI TTAA 4 cut(s) 35, 63, 240, 401
SatI GCNGC 1 cut(s) 191
Sau96I GGNCC 1 cut(s) 109
Sse9I AATT 7 cut(s) 60, 78, 135, 292, 430, 439, 556
SsiI CCGC 1 cut(s) 208
SspMI CTAG 2 cut(s) 311, 336
TaaI ACNGT 2 cut(s) 88, 549
TaqI TCGA 2 cut(s) 18, 374
TasI AATT 7 cut(s) 60, 78, 135, 292, 430, 439, 556
TfiI GAWTC 4 cut(s) 128, 307, 344, 371
Tru1I TTAA 4 cut(s) 35, 63, 240, 401
Tru9I TTAA 4 cut(s) 35, 63, 240, 401
TscAI CASTG 1 cut(s) 459
TseFI GTSAC 1 cut(s) 184
TseI GCWGC 1 cut(s) 190
Tsp45I GTSAC 1 cut(s) 184
TspDTI ATGAA 2 cut(s) 111, 293
TspRI CASTG 1 cut(s) 459
XapI RAATTY 3 cut(s) 292, 430, 439
XspI CTAG 2 cut(s) 311, 336
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.