Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0008973.1

Orthogroup ID

OG0002386

Physical Location & Seq

Genomic Coordinates Reverse (-)

77050 .. 80687

Gene Structure 3638 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0008973.1_g000015.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 930 bp

atgtcggaatctaggactccagttacccgaggaacagaaggttcgcgactctcgaagtacgtgaaagcaagcaccggaatccaagtaggggattcaggactctcctcggttttttcacccaacaaggagcttggaggcccagcatcaggtgatggaagtccaagacgagactatcagtttcacccaacaaggagcttggaggcccagccttcacaaggctggggggggggtctctcttttcgcaagtgtggctgcgtttttaggacttgggtttggacttcaccggcaaaaccatcgaaataccaatgcgcaagtgtggctcgtttttgggacttgggtttggaattctgggaaacgcaaacattctttgagaatacaagtggtattggcattcctatcaaggtgaataacatcactttagagaggagatgtggttcatttgtccatatgttgattgatactgaccttacaattggtccccctttggatttggttgtggaaagggaaggtaatgagacgtttccggtgcagaggaatcggggctcggatcagttgtttaccatcgtcggcgccgtttcgttcagtggggcagctgtttggtctgcagagaggaggccgccggagggatggatggcggtagaggaagcttggccaatggaggctagggctgctatcgtctctgctcaggtatgggcttgggcttttgggcttgtacttgaatttgggttgatgggctcttctccatctgctcggatttgggcttggtctttggagcctgggctcgaactcaagcttgggctggttgagtttgttgcagttgcttcggataagaagagcaagaccaacctgttgccgaggttgttggctcctgacgaggccgaggatggtgctggctccaaccctaaggggaaggagctagcatttttctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF4283 zf-CCHC_4

Protein Analysis

309

Amino Acids

33.71

Weight (kDa)

5.89

Isoelectric Point (pI)

34.14

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002386)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G01870 AT4G01870
fragaria_vesca	FvH4_1g26490
malus_domestica	MD17G1281200.v1.1
prunus_persica	Prupe.3G004400_v2.0.a1
pyrus_communis	pycom09g02860 pycom10g10260 pycom17g27890
rosa_chinensis	RchiOBHm_Chr2g0147951 RchiOBHm_Chr3g0485261 RchiOBHm_Chr3g0486551 RchiOBHm_Chr6g0276991 RchiOBHm_Chr6g0277001
rosa_laevigata	RLG00000023077 RLG00000024900 RLG00000033827
rosa_multiflora	Rmu_sc0000308.1_g000067 Rmu_sc0001260.1_g000030 Rmu_sc0003040.1_g000011 Rmu_sc0003801.1_g000028 Rmu_sc0003801.1_g000029 Rmu_sc0008973.1_g000015 Rmu_sc0011408.1_g000002 Rmu_sc0011408.1_g000004 Rmu_sc0011943.1_g000001 Rmu_sc0032328.1_g000001 Rmu_sc0040736.1_g000001
rosa_roxburghii	Rroxscaffold_2G00138000 Rroxscaffold_4G00302670 Rroxscaffold_5G00344080 Rroxscaffold_5G00373530 Rroxscaffold_6G00395800
rosa_rugosa	Rorug03G0225100
rosa_samantha	Rh3AG275100 Rh3BG310200 Rh3CG309400 Rh3DG306200 Rh4BG238600 Rh6BG152100 Rh6CG318000 Rh6DG302900
rosa_wichuraiana	Rw3G024520

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	310
AccB1I	GGYRCC	1 cut(s)	569
AccII	CGCG	1 cut(s)	46
AciI	CCGC	2 cut(s)	617, 635
AclWI	GGATC	1 cut(s)	555
AcoI	YGGCCR	1 cut(s)	650
AcsI	RAATTY	2 cut(s)	344, 719
AcyI	GRCGYC	1 cut(s)	570
AfaI	GTAC	2 cut(s)	59, 714
AfiI	CCNNNNNNNGG	4 cut(s)	88, 146, 215, 623
AgsI	TTSAA	1 cut(s)	719
AjnI	CCWGG	1 cut(s)	775
AjuI	GAANNNNNNNTTGG	2 cut(s)	777, 809
AloI	GAACNNNNNNTCC	2 cut(s)	418, 450
AluBI	AGCT	6 cut(s)	130, 195, 593, 647, 793, 916
AluI	AGCT	6 cut(s)	130, 195, 593, 647, 793, 916
Alw26I	GTCTC	4 cut(s)	162, 236, 509, 682
AlwI	GGATC	1 cut(s)	555
Ama87I	CYCGRG	1 cut(s)	27
AoxI	GGCC	5 cut(s)	136, 201, 614, 650, 876
ApeKI	GCWGC	3 cut(s)	252, 590, 668
ApoI	RAATTY	2 cut(s)	344, 719
AspLEI	GCGC	2 cut(s)	311, 572
AspS9I	GGNCC	3 cut(s)	137, 202, 476
AsuHPI	GGTGA	5 cut(s)	108, 161, 173, 273, 415
AsuNHI	GCTAGC	1 cut(s)	916
AvaI	CYCGRG	1 cut(s)	27
AvaII	GGWCC	1 cut(s)	476
AxyI	CCTNAGG	1 cut(s)	903
BalI	TGGCCA	1 cut(s)	652
BanI	GGYRCC	1 cut(s)	569
BanII	GRGCYC	3 cut(s)	545, 737, 783
BbvI	GCAGC	3 cut(s)	239, 602, 655
BccI	CCATC	8 cut(s)	146, 301, 569, 621, 625, 724, 751, 878
BceAI	ACGGC	1 cut(s)	557
BcgI	CGANNNNNNTGC	8 cut(s)	276, 310, 518, 552, 804, 838, 869, 903
BciT130I	CCWGG	1 cut(s)	777
BcoDI	GTCTC	4 cut(s)	162, 236, 509, 682
BfaI	CTAG	4 cut(s)	12, 663, 917, 928
BfmI	CTRYAG	1 cut(s)	603
BfoI	RGCGCY	1 cut(s)	573
BisI	GCNGC	4 cut(s)	253, 591, 617, 669
BlsI	GCNGC	4 cut(s)	254, 592, 618, 670
Bme1390I	CCNGG	1 cut(s)	777
Bme18I	GGWCC	1 cut(s)	476
BmeT110I	CYCGRG	1 cut(s)	27
BmgT120I	GGNCC	3 cut(s)	137, 202, 476
BmiI	GGNNCC	5 cut(s)	478, 571, 774, 867, 895
BmrFI	CCNGG	1 cut(s)	777
BmsI	GCATC	1 cut(s)	152
BmtI	GCTAGC	1 cut(s)	920
Bpu10I	CCTNAGC	1 cut(s)	684
BpuEI	CTTGAG	1 cut(s)	773
BsaAI	YACGTR	1 cut(s)	61
BsaHI	GRCGYC	1 cut(s)	570
BsaI	GGTCTC	1 cut(s)	236
BsaJI	CCNNGG	5 cut(s)	28, 105, 776, 854, 879
BsaWI	WCCGGW	2 cut(s)	74, 523
BsaXI	ACNNNNNCTCC	2 cut(s)	418, 448
Bsc4I	CCNNNNNNNGG	4 cut(s)	88, 146, 215, 623
Bse118I	RCCGGY	1 cut(s)	283
Bse1I	ACTGG	1 cut(s)	20
Bse21I	CCTNAGG	1 cut(s)	903
BseBI	CCWGG	1 cut(s)	777
BseDI	CCNNGG	5 cut(s)	28, 105, 776, 854, 879
BseGI	GGATG	3 cut(s)	632, 636, 889
BseLI	CCNNNNNNNGG	4 cut(s)	88, 146, 215, 623
BseMII	CTCAG	1 cut(s)	698
BseNI	ACTGG	1 cut(s)	20
BseRI	GAGGAG	3 cut(s)	94, 439, 625
BseXI	GCAGC	3 cut(s)	239, 602, 655
BseYI	CCCAGC	3 cut(s)	139, 204, 219
BsgI	GTGCAG	1 cut(s)	548
Bsh1236I	CGCG	1 cut(s)	46
BshFI	GGCC	5 cut(s)	138, 203, 616, 652, 878
BshNI	GGYRCC	1 cut(s)	569
BsiHKCI	CYCGRG	1 cut(s)	27
BsiSI	CCGG	4 cut(s)	75, 284, 524, 620
BslFI	GGGAC	2 cut(s)	344, 462
BslI	CCNNNNNNNGG	4 cut(s)	88, 146, 215, 623
BsmAI	GTCTC	4 cut(s)	162, 236, 509, 682
BsmBI	CGTCTC	2 cut(s)	509, 682
BsmFI	GGGAC	2 cut(s)	344, 462
BsmI	GAATGC	1 cut(s)	390
BsnI	GGCC	5 cut(s)	138, 203, 616, 652, 878
Bso31I	GGTCTC	1 cut(s)	236
BsoBI	CYCGRG	1 cut(s)	27
Bsp1286I	GDGCHC	3 cut(s)	545, 737, 783
Bsp143I	GATC	1 cut(s)	547
Bsp68I	TCGCGA	1 cut(s)	46
BspACI	CCGC	2 cut(s)	617, 635
BspANI	GGCC	5 cut(s)	138, 203, 616, 652, 878
BspCNI	CTCAG	1 cut(s)	697
BspFNI	CGCG	1 cut(s)	46
BspLI	GGNNCC	5 cut(s)	478, 571, 774, 867, 895
BspMAI	CTGCAG	1 cut(s)	607
BspOI	GCTAGC	1 cut(s)	920
BspPI	GGATC	1 cut(s)	555
BspQI	GCTCTTC	2 cut(s)	742, 827
BspT107I	GGYRCC	1 cut(s)	569
BspTNI	GGTCTC	1 cut(s)	236
BsrFI	RCCGGY	1 cut(s)	283
BsrI	ACTGG	1 cut(s)	20
BssAI	RCCGGY	1 cut(s)	283
BssECI	CCNNGG	5 cut(s)	28, 105, 776, 854, 879
BssMI	GATC	1 cut(s)	547
BssNI	GRCGYC	1 cut(s)	570
Bst2UI	CCWGG	1 cut(s)	777
Bst6I	CTCTTC	2 cut(s)	742, 827
BstACI	GRCGYC	1 cut(s)	570
BstBAI	YACGTR	1 cut(s)	61
BstC8I	GCNNGC	3 cut(s)	70, 892, 918
BstDEI	CTNAG	2 cut(s)	684, 903
BstENI	CCTNNNNNAGG	1 cut(s)	213
BstF5I	GGATG	3 cut(s)	632, 636, 889
BstFNI	CGCG	1 cut(s)	46
BstH2I	RGCGCY	1 cut(s)	573
BstHHI	GCGC	2 cut(s)	311, 572
BstKTI	GATC	1 cut(s)	550
BstMAI	GTCTC	4 cut(s)	162, 236, 509, 682
BstMBI	GATC	1 cut(s)	547
BstMWI	GCNNNNNNNGC	3 cut(s)	249, 317, 668
BstNI	CCWGG	1 cut(s)	777
BstSCI	CCNGG	1 cut(s)	775
BstSFI	CTRYAG	1 cut(s)	603
BstUI	CGCG	1 cut(s)	46
BstV1I	GCAGC	3 cut(s)	239, 602, 655
Bsu36I	CCTNAGG	1 cut(s)	903
BsuRI	GGCC	5 cut(s)	138, 203, 616, 652, 878
BtsCI	GGATG	3 cut(s)	632, 636, 889
BtsIMutI	CAGTG	1 cut(s)	589
BtuMI	TCGCGA	1 cut(s)	46
Cac8I	GCNNGC	3 cut(s)	70, 892, 918
CfoI	GCGC	2 cut(s)	311, 572
Cfr10I	RCCGGY	1 cut(s)	283
Cfr13I	GGNCC	3 cut(s)	137, 202, 476
Csp6I	GTAC	2 cut(s)	58, 713
CviQI	GTAC	2 cut(s)	58, 713
DdeI	CTNAG	2 cut(s)	684, 903
DinI	GGCGCC	1 cut(s)	571
DpnI	GATC	1 cut(s)	549
DpnII	GATC	1 cut(s)	547
EaeI	YGGCCR	1 cut(s)	650
Eam1104I	CTCTTC	2 cut(s)	742, 827
EarI	CTCTTC	2 cut(s)	742, 827
Eco24I	GRGCYC	3 cut(s)	545, 737, 783
Eco31I	GGTCTC	1 cut(s)	236
Eco47I	GGWCC	1 cut(s)	476
Eco81I	CCTNAGG	1 cut(s)	903
Eco88I	CYCGRG	1 cut(s)	27
EcoNI	CCTNNNNNAGG	1 cut(s)	213
EcoRI	GAATTC	1 cut(s)	344
EcoRII	CCWGG	1 cut(s)	775
EcoT38I	GRGCYC	3 cut(s)	545, 737, 783
EgeI	GGCGCC	1 cut(s)	571
EheI	GGCGCC	1 cut(s)	571
Esp3I	CGTCTC	2 cut(s)	509, 682
FaiI	YATR	3 cut(s)	447, 449, 691
FaqI	GGGAC	2 cut(s)	344, 462
FauNDI	CATATG	1 cut(s)	447
Fnu4HI	GCNGC	4 cut(s)	253, 591, 617, 669
FokI	GGATG	3 cut(s)	639, 643, 896
FriOI	GRGCYC	3 cut(s)	545, 737, 783
Fsp4HI	GCNGC	4 cut(s)	253, 591, 617, 669
FspBI	CTAG	4 cut(s)	12, 663, 917, 928
FspI	TGCGCA	1 cut(s)	310
GlaI	GCGC	2 cut(s)	310, 571
GluI	GCNGC	4 cut(s)	253, 591, 617, 669
GsaI	CCCAGC	3 cut(s)	143, 208, 223
HaeII	RGCGCY	1 cut(s)	573
HaeIII	GGCC	5 cut(s)	138, 203, 616, 652, 878
HapII	CCGG	4 cut(s)	75, 284, 524, 620
HhaI	GCGC	2 cut(s)	311, 572
Hin1I	GRCGYC	1 cut(s)	570
Hin6I	GCGC	2 cut(s)	309, 570
HinP1I	GCGC	2 cut(s)	309, 570
HindIII	AAGCTT	2 cut(s)	645, 791
HinfI	GANTC	7 cut(s)	8, 16, 48, 78, 92, 99, 535
HpaII	CCGG	4 cut(s)	75, 284, 524, 620
HphI	GGTGA	5 cut(s)	108, 161, 173, 273, 415
Hpy166II	GTNNAC	1 cut(s)	558
Hpy188I	TCNGA	4 cut(s)	7, 547, 753, 826
Hpy188III	TCNNGA	4 cut(s)	45, 52, 96, 869
Hpy8I	GTNNAC	1 cut(s)	558
Hpy99I	CGWCG	1 cut(s)	569
HpyAV	CCTTC	4 cut(s)	32, 219, 500, 904
HpyCH4IV	ACGT	2 cut(s)	60, 518
HpyCH4V	TGCA	3 cut(s)	529, 605, 815
HpyF10VI	GCNNNNNNNGC	3 cut(s)	249, 317, 668
HpyF3I	CTNAG	2 cut(s)	684, 903
HpySE526I	ACGT	2 cut(s)	60, 518
Hsp92I	GRCGYC	1 cut(s)	570
HspAI	GCGC	2 cut(s)	309, 570
KasI	GGCGCC	1 cut(s)	569
Kzo9I	GATC	1 cut(s)	547
LguI	GCTCTTC	2 cut(s)	742, 827
LmnI	GCTCC	6 cut(s)	127, 192, 772, 871, 899, 913
Lsp1109I	GCAGC	3 cut(s)	239, 602, 655
LweI	GCATC	1 cut(s)	152
MaeI	CTAG	4 cut(s)	12, 663, 917, 928
MaeII	ACGT	2 cut(s)	60, 518
MaeIII	GTNAC	1 cut(s)	22
MalI	GATC	1 cut(s)	549
MboI	GATC	1 cut(s)	547
MboII	GAAGA	2 cut(s)	729, 844
MfeI	CAATTG	1 cut(s)	471
MhlI	GDGCHC	3 cut(s)	545, 737, 783
MlsI	TGGCCA	1 cut(s)	652
MluCI	AATT	3 cut(s)	344, 471, 719
MluNI	TGGCCA	1 cut(s)	652
Mly113I	GGCGCC	1 cut(s)	570
MlyI	GAGTC	3 cut(s)	10, 42, 93
MmeI	TCCRAC	1 cut(s)	921
Mox20I	TGGCCA	1 cut(s)	652
MscI	TGGCCA	1 cut(s)	652
Msp20I	TGGCCA	1 cut(s)	652
MspA1I	CMGCKG	1 cut(s)	593
MspI	CCGG	4 cut(s)	75, 284, 524, 620
MspR9I	CCNGG	1 cut(s)	777
MunI	CAATTG	1 cut(s)	471
Mva1269I	GAATGC	1 cut(s)	390
MvaI	CCWGG	1 cut(s)	777
MvnI	CGCG	1 cut(s)	46
MwoI	GCNNNNNNNGC	3 cut(s)	249, 317, 668
NarI	GGCGCC	1 cut(s)	570
NdeI	CATATG	1 cut(s)	447
NdeII	GATC	1 cut(s)	547
NheI	GCTAGC	1 cut(s)	916
NlaIV	GGNNCC	5 cut(s)	478, 571, 774, 867, 895
NmeAIII	GCCGAG	2 cut(s)	879, 904
NruI	TCGCGA	1 cut(s)	46
NsbI	TGCGCA	1 cut(s)	310
PciSI	GCTCTTC	2 cut(s)	742, 827
PcsI	WCGNNNNNNNCGW	2 cut(s)	50, 570
PctI	GAATGC	1 cut(s)	390
PfeI	GAWTC	4 cut(s)	8, 78, 92, 535
PkrI	GCNGC	4 cut(s)	254, 592, 618, 670
PleI	GAGTC	3 cut(s)	10, 42, 93
PluTI	GGCGCC	1 cut(s)	573
PpsI	GAGTC	3 cut(s)	10, 42, 93
Ppu21I	YACGTR	1 cut(s)	61
Psp6I	CCWGG	1 cut(s)	775
PspFI	CCCAGC	3 cut(s)	139, 204, 219
PspGI	CCWGG	1 cut(s)	775
PspN4I	GGNNCC	5 cut(s)	478, 571, 774, 867, 895
PspPI	GGNCC	3 cut(s)	137, 202, 476
PstI	CTGCAG	1 cut(s)	607
PvuII	CAGCTG	1 cut(s)	593
RruI	TCGCGA	1 cut(s)	46
RsaI	GTAC	2 cut(s)	59, 714
RsaNI	GTAC	2 cut(s)	58, 713
SapI	GCTCTTC	2 cut(s)	742, 827
SatI	GCNGC	4 cut(s)	253, 591, 617, 669
Sau3AI	GATC	1 cut(s)	547
Sau96I	GGNCC	3 cut(s)	137, 202, 476
SchI	GAGTC	3 cut(s)	10, 42, 93
ScrFI	CCNGG	1 cut(s)	777
SduI	GDGCHC	3 cut(s)	545, 737, 783
SfaNI	GCATC	1 cut(s)	152
SfcI	CTRYAG	1 cut(s)	603
SfoI	GGCGCC	1 cut(s)	571
SinI	GGWCC	1 cut(s)	476
SmlI	CTYRAG	1 cut(s)	788
SmoI	CTYRAG	1 cut(s)	788
Sse9I	AATT	3 cut(s)	344, 471, 719
SsiI	CCGC	2 cut(s)	617, 635
SspDI	GGCGCC	1 cut(s)	569
SspMI	CTAG	4 cut(s)	12, 663, 917, 928
StyD4I	CCNGG	1 cut(s)	775
TaiI	ACGT	2 cut(s)	63, 521
TaqI	TCGA	3 cut(s)	53, 296, 783
TasI	AATT	3 cut(s)	344, 471, 719
TatI	WGTACW	1 cut(s)	712
TauI	GCSGC	1 cut(s)	619
TfiI	GAWTC	4 cut(s)	8, 78, 92, 535
TscAI	CASTG	1 cut(s)	589
TseI	GCWGC	3 cut(s)	252, 590, 668
TspDTI	ATGAA	1 cut(s)	426
TspRI	CASTG	1 cut(s)	589
VpaK11BI	GGWCC	1 cut(s)	476
XagI	CCTNNNNNAGG	1 cut(s)	213
XapI	RAATTY	2 cut(s)	344, 719
XspI	CTAG	4 cut(s)	12, 663, 917, 928

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.