Rroxscaffold_5G00344080

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0002386
Physical Location & Seq
Forward (+)
14004481 .. 14008506
4026 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00344080.1

Sequence Viewer

Length: 249 bp
ATGGCTGCGCCGTTTGGACCTGTGCATGCTAGCAAGAGGAAGCCGGCGACAATGAAGGTAGGAAACGGTGGAGCACCAAATGGAAGGACGACGACGAGCGCGCCAAGAAGCACAAGCTCCTCCTCGGAATCAACCGCCAACAGCACAATCGCCGTTCAATTCGGCCCCTACGGCTCCGATTCCAATGCCGACGATGATGATCCGGACAAGATCGAATCCAATCATACGGTGATCATCGACCTCGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

8.41

Weight (kDa)

5.1

Isoelectric Point (pI)

41.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 101
AccIII TCCGGA 1 cut(s) 202
AciI CCGC 1 cut(s) 135
AclWI GGATC 1 cut(s) 194
AgsI TTSAA 1 cut(s) 158
AluBI AGCT 1 cut(s) 117
AluI AGCT 1 cut(s) 117
Alw21I GWGCWC 1 cut(s) 76
AlwI GGATC 1 cut(s) 194
Aor13HI TCCGGA 1 cut(s) 202
AoxI GGCC 1 cut(s) 163
ApeKI GCWGC 1 cut(s) 5
AspLEI GCGC 3 cut(s) 10, 101, 103
AspS9I GGNCC 2 cut(s) 17, 164
AsuHPI GGTGA 1 cut(s) 241
AsuNHI GCTAGC 1 cut(s) 29
AvaII GGWCC 1 cut(s) 17
Bbv12I GWGCWC 1 cut(s) 76
BceAI ACGGC 2 cut(s) 137, 187
BcgI CGANNNNNNTGC 2 cut(s) 167, 201
BclI TGATCA 1 cut(s) 231
BfaI CTAG 1 cut(s) 30
BglI GCCNNNNNGGC 1 cut(s) 171
BisI GCNGC 1 cut(s) 6
BlsI GCNGC 1 cut(s) 7
Bme18I GGWCC 1 cut(s) 17
BmgT120I GGNCC 2 cut(s) 17, 164
BmiI GGNNCC 2 cut(s) 166, 175
BmtI GCTAGC 1 cut(s) 33
BsaBI GATNNNNATC 1 cut(s) 198
BsaJI CCNNGG 1 cut(s) 123
BsaWI WCCGGW 1 cut(s) 202
Bse118I RCCGGY 1 cut(s) 43
Bse8I GATNNNNATC 1 cut(s) 198
BseAI TCCGGA 1 cut(s) 202
BseDI CCNNGG 1 cut(s) 123
BseJI GATNNNNATC 1 cut(s) 198
BsePI GCGCGC 1 cut(s) 99
BseRI GAGGAG 2 cut(s) 109, 112
Bsh1236I CGCG 1 cut(s) 101
BshFI GGCC 1 cut(s) 165
BsiHKAI GWGCWC 1 cut(s) 76
BsiSI CCGG 2 cut(s) 44, 203
BsnI GGCC 1 cut(s) 165
Bsp1286I GDGCHC 1 cut(s) 76
Bsp13I TCCGGA 1 cut(s) 202
Bsp143I GATC 3 cut(s) 199, 210, 231
BspACI CCGC 1 cut(s) 135
BspANI GGCC 1 cut(s) 165
BspEI TCCGGA 1 cut(s) 202
BspFNI CGCG 1 cut(s) 101
BspLI GGNNCC 2 cut(s) 166, 175
BspOI GCTAGC 1 cut(s) 33
BspPI GGATC 1 cut(s) 194
BsrFI RCCGGY 1 cut(s) 43
BssAI RCCGGY 1 cut(s) 43
BssECI CCNNGG 1 cut(s) 123
BssHII GCGCGC 1 cut(s) 99
BssMI GATC 3 cut(s) 199, 210, 231
Bst4CI ACNGT 2 cut(s) 68, 229
BstC8I GCNNGC 4 cut(s) 27, 31, 45, 101
BstFNI CGCG 1 cut(s) 101
BstHHI GCGC 3 cut(s) 10, 101, 103
BstKTI GATC 3 cut(s) 202, 213, 234
BstMBI GATC 3 cut(s) 199, 210, 231
BstMWI GCNNNNNNNGC 1 cut(s) 171
BstNSI RCATGY 1 cut(s) 29
BstUI CGCG 1 cut(s) 101
BsuRI GGCC 1 cut(s) 165
Cac8I GCNNGC 4 cut(s) 27, 31, 45, 101
CfoI GCGC 3 cut(s) 10, 101, 103
Cfr10I RCCGGY 1 cut(s) 43
Cfr13I GGNCC 2 cut(s) 17, 164
CviAII CATG 1 cut(s) 26
CviJI RGCY 5 cut(s) 5, 43, 117, 165, 174
CviKI_1 RGCY 5 cut(s) 5, 43, 117, 165, 174
DpnI GATC 3 cut(s) 201, 212, 233
DpnII GATC 3 cut(s) 199, 210, 231
Eco47I GGWCC 1 cut(s) 17
FaeI CATG 1 cut(s) 29
FaiI YATR 2 cut(s) 27, 225
FatI CATG 1 cut(s) 25
FbaI TGATCA 1 cut(s) 231
Fnu4HI GCNGC 1 cut(s) 6
Fsp4HI GCNGC 1 cut(s) 6
FspBI CTAG 1 cut(s) 30
GlaI GCGC 3 cut(s) 9, 100, 102
GluI GCNGC 1 cut(s) 6
HaeIII GGCC 1 cut(s) 165
HapII CCGG 2 cut(s) 44, 203
HhaI GCGC 3 cut(s) 10, 101, 103
Hin1II CATG 1 cut(s) 29
Hin6I GCGC 3 cut(s) 8, 99, 101
HinP1I GCGC 3 cut(s) 8, 99, 101
HinfI GANTC 3 cut(s) 128, 179, 215
HpaII CCGG 2 cut(s) 44, 203
HphI GGTGA 1 cut(s) 241
Hpy188I TCNGA 2 cut(s) 127, 178
Hpy188III TCNNGA 1 cut(s) 203
Hpy99I CGWCG 3 cut(s) 94, 97, 194
HpyAV CCTTC 2 cut(s) 49, 78
HpyCH4III ACNGT 2 cut(s) 68, 229
HpyCH4V TGCA 1 cut(s) 25
HpyF10VI GCNNNNNNNGC 1 cut(s) 171
Hsp92II CATG 1 cut(s) 29
HspAI GCGC 3 cut(s) 8, 99, 101
Kpn2I TCCGGA 1 cut(s) 202
KroI GCCGGC 1 cut(s) 43
KroNI GCCGGC 1 cut(s) 45
Ksp22I TGATCA 1 cut(s) 231
Kzo9I GATC 3 cut(s) 199, 210, 231
LmnI GCTCC 3 cut(s) 71, 122, 179
LpnPI CCDG 3 cut(s) 33, 57, 216
MaeI CTAG 1 cut(s) 30
MalI GATC 3 cut(s) 201, 212, 233
MboI GATC 3 cut(s) 199, 210, 231
MhlI GDGCHC 1 cut(s) 76
MluCI AATT 1 cut(s) 158
MnlI CCTC 3 cut(s) 30, 130, 133
MroI TCCGGA 1 cut(s) 202
MroNI GCCGGC 1 cut(s) 43
MspI CCGG 2 cut(s) 44, 203
MvnI CGCG 1 cut(s) 101
MwoI GCNNNNNNNGC 1 cut(s) 171
NaeI GCCGGC 1 cut(s) 45
NdeII GATC 3 cut(s) 199, 210, 231
NgoMIV GCCGGC 1 cut(s) 43
NheI GCTAGC 1 cut(s) 29
NlaIII CATG 1 cut(s) 29
NlaIV GGNNCC 2 cut(s) 166, 175
NspI RCATGY 1 cut(s) 29
PaeI GCATGC 1 cut(s) 29
PauI GCGCGC 1 cut(s) 99
PdiI GCCGGC 1 cut(s) 45
PfeI GAWTC 3 cut(s) 128, 179, 215
PkrI GCNGC 1 cut(s) 7
PspN4I GGNNCC 2 cut(s) 166, 175
PspPI GGNCC 2 cut(s) 17, 164
PteI GCGCGC 1 cut(s) 99
SatI GCNGC 1 cut(s) 6
Sau3AI GATC 3 cut(s) 199, 210, 231
Sau96I GGNCC 2 cut(s) 17, 164
SduI GDGCHC 1 cut(s) 76
SetI ASST 4 cut(s) 22, 60, 119, 243
SinI GGWCC 1 cut(s) 17
SphI GCATGC 1 cut(s) 29
Sse9I AATT 1 cut(s) 158
SsiI CCGC 1 cut(s) 135
SspMI CTAG 1 cut(s) 30
TaaI ACNGT 2 cut(s) 68, 229
TaqI TCGA 3 cut(s) 213, 237, 243
TasI AATT 1 cut(s) 158
TfiI GAWTC 3 cut(s) 128, 179, 215
TseI GCWGC 1 cut(s) 5
TspDTI ATGAA 1 cut(s) 68
VpaK11BI GGWCC 1 cut(s) 17
XceI RCATGY 1 cut(s) 29
XspI CTAG 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.