Rmu_sc0010560.1_g000004

UDP-galactose UDP-glucose transporter

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010560.1
Physical Location & Seq
Forward (+)
20144 .. 21286
1143 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010560.1_g000004.1.cds

Sequence Viewer

Length: 558 bp
atggtaaacccatggaagacttatgtgaagctatctgctgtgcttatgggctctcatggacttaccaaaggctccttggcttttctcaactaccctgcacagctaatgttcaaatcaacaaaggttttgcctgtgatgataatgggagcgttcataccaggtttgaggcggaagtacccacctcatgagtacgtttctgcaatccttctggtggtgggtctgatcctattcaccttagcggatgcacaaacgtctcccaacttcagcgtgattggtgtggtgatggtatcgggtgctctagtcatggattcgtttttgggtaatttgcaagaagcaatatttaccatgaatcctgaaaccacacagatggagatgttgttttgctctacagtagttggtctacctttcttggtgccaccaatgattttgacaggagaattattcaaagcgtggagttcatgttctcagcatccatacgtatatggtgtgttagtctttgaagccatggccacgtttattggccaagtttctgtcctttccctcaattatctttcttga

Protein Analysis

185

Amino Acids

20.24

Weight (kDa)

7.77

Isoelectric Point (pI)

28.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 412
AccI GTMKAC 1 cut(s) 400
AciI CCGC 2 cut(s) 169, 239
AclWI GGATC 1 cut(s) 217
AcoI YGGCCR 2 cut(s) 507, 520
AcuI CTGAAG 1 cut(s) 247
AfaI GTAC 2 cut(s) 176, 191
AfiI CCNNNNNNNGG 1 cut(s) 211
AgsI TTSAA 3 cut(s) 112, 445, 500
AjnI CCWGG 1 cut(s) 157
AloI GAACNNNNNNTCC 2 cut(s) 445, 477
AluBI AGCT 2 cut(s) 31, 103
AluI AGCT 2 cut(s) 31, 103
Alw21I GWGCWC 1 cut(s) 298
Alw26I GTCTC 1 cut(s) 258
AlwI GGATC 1 cut(s) 217
AoxI GGCC 2 cut(s) 507, 520
AsuHPI GGTGA 2 cut(s) 223, 292
BalI TGGCCA 2 cut(s) 509, 522
BanI GGYRCC 1 cut(s) 412
BanII GRGCYC 1 cut(s) 53
BbsI GAAGAC 1 cut(s) 23
Bbv12I GWGCWC 1 cut(s) 298
BccI CCATC 2 cut(s) 277, 361
BciT130I CCWGG 1 cut(s) 159
BcoDI GTCTC 1 cut(s) 258
BfaI CTAG 1 cut(s) 299
BfmI CTRYAG 1 cut(s) 387
Bme1390I CCNGG 1 cut(s) 159
BmiI GGNNCC 2 cut(s) 73, 414
BmrFI CCNGG 1 cut(s) 159
BmsI GCATC 2 cut(s) 232, 478
BpiI GAAGAC 1 cut(s) 23
Bpu10I CCTNAGC 1 cut(s) 235
BsaAI YACGTR 1 cut(s) 478
BsaJI CCNNGG 3 cut(s) 11, 75, 504
BsaXI ACNNNNNCTCC 4 cut(s) 362, 392, 445, 475
Bsc4I CCNNNNNNNGG 1 cut(s) 211
BseBI CCWGG 1 cut(s) 159
BseDI CCNNGG 3 cut(s) 11, 75, 504
BseGI GGATG 2 cut(s) 247, 469
BseLI CCNNNNNNNGG 1 cut(s) 211
BseMII CTCAG 1 cut(s) 479
BsgI GTGCAG 1 cut(s) 81
BshFI GGCC 2 cut(s) 509, 522
BshNI GGYRCC 1 cut(s) 412
BsiHKAI GWGCWC 1 cut(s) 298
BslI CCNNNNNNNGG 1 cut(s) 211
BsmAI GTCTC 1 cut(s) 258
BsmBI CGTCTC 1 cut(s) 258
BsnI GGCC 2 cut(s) 509, 522
Bsp1286I GDGCHC 2 cut(s) 53, 298
Bsp143I GATC 1 cut(s) 222
Bsp19I CCATGG 2 cut(s) 11, 504
BspACI CCGC 2 cut(s) 169, 239
BspANI GGCC 2 cut(s) 509, 522
BspCNI CTCAG 1 cut(s) 478
BspHI TCATGA 1 cut(s) 184
BspLI GGNNCC 2 cut(s) 73, 414
BspPI GGATC 1 cut(s) 217
BspT107I GGYRCC 1 cut(s) 412
BssECI CCNNGG 3 cut(s) 11, 75, 504
BssMI GATC 1 cut(s) 222
BssT1I CCWWGG 3 cut(s) 11, 75, 504
Bst2UI CCWGG 1 cut(s) 159
Bst4CI ACNGT 1 cut(s) 391
BstBAI YACGTR 1 cut(s) 478
BstDEI CTNAG 2 cut(s) 235, 465
BstDSI CCRYGG 2 cut(s) 11, 504
BstF5I GGATG 2 cut(s) 247, 469
BstKTI GATC 1 cut(s) 225
BstMAI GTCTC 1 cut(s) 258
BstMBI GATC 1 cut(s) 222
BstNI CCWGG 1 cut(s) 159
BstSCI CCNGG 1 cut(s) 157
BstSFI CTRYAG 1 cut(s) 387
BstSNI TACGTA 1 cut(s) 478
BstV2I GAAGAC 1 cut(s) 23
BstXI CCANNNNNNTGG 1 cut(s) 367
BsuRI GGCC 2 cut(s) 509, 522
BtgI CCRYGG 2 cut(s) 11, 504
BtsCI GGATG 2 cut(s) 247, 469
CciI TCATGA 1 cut(s) 184
CsiI ACCWGGT 1 cut(s) 157
Csp6I GTAC 2 cut(s) 175, 190
CspCI CAANNNNNGTGG 2 cut(s) 499, 534
CviAII CATG 7 cut(s) 12, 56, 185, 304, 346, 459, 505
CviJI RGCY 8 cut(s) 31, 51, 72, 80, 103, 503, 509, 522
CviKI_1 RGCY 8 cut(s) 31, 51, 72, 80, 103, 503, 509, 522
CviQI GTAC 2 cut(s) 175, 190
DdeI CTNAG 2 cut(s) 235, 465
DpnI GATC 1 cut(s) 224
DpnII GATC 1 cut(s) 222
EaeI YGGCCR 2 cut(s) 507, 520
EciI GGCGGA 1 cut(s) 184
Eco105I TACGTA 1 cut(s) 478
Eco130I CCWWGG 3 cut(s) 11, 75, 504
Eco24I GRGCYC 1 cut(s) 53
Eco57I CTGAAG 1 cut(s) 247
EcoRII CCWGG 1 cut(s) 157
EcoT14I CCWWGG 3 cut(s) 11, 75, 504
EcoT38I GRGCYC 1 cut(s) 53
ErhI CCWWGG 3 cut(s) 11, 75, 504
Esp3I CGTCTC 1 cut(s) 258
FaeI CATG 7 cut(s) 15, 59, 188, 307, 349, 462, 508
FatI CATG 7 cut(s) 11, 55, 184, 303, 345, 458, 504
FblI GTMKAC 1 cut(s) 400
FokI GGATG 2 cut(s) 254, 456
FriOI GRGCYC 1 cut(s) 53
FspBI CTAG 1 cut(s) 299
HaeIII GGCC 2 cut(s) 509, 522
Hin1II CATG 7 cut(s) 15, 59, 188, 307, 349, 462, 508
HinfI GANTC 2 cut(s) 308, 349
HphI GGTGA 2 cut(s) 223, 292
Hpy166II GTNNAC 2 cut(s) 7, 401
Hpy188I TCNGA 1 cut(s) 222
Hpy188III TCNNGA 3 cut(s) 185, 353, 555
Hpy8I GTNNAC 2 cut(s) 7, 401
HpyAV CCTTC 1 cut(s) 215
HpyCH4III ACNGT 1 cut(s) 391
HpyCH4IV ACGT 4 cut(s) 192, 251, 477, 512
HpyCH4V TGCA 4 cut(s) 98, 200, 245, 328
HpyF3I CTNAG 2 cut(s) 235, 465
HpySE526I ACGT 4 cut(s) 192, 251, 477, 512
Hsp92II CATG 7 cut(s) 15, 59, 188, 307, 349, 462, 508
Kzo9I GATC 1 cut(s) 222
LmnI GCTCC 2 cut(s) 77, 146
LpnPI CCDG 7 cut(s) 108, 144, 144, 171, 194, 366, 417
LweI GCATC 2 cut(s) 232, 478
MabI ACCWGGT 1 cut(s) 157
MaeI CTAG 1 cut(s) 299
MaeII ACGT 4 cut(s) 192, 251, 477, 512
MalI GATC 1 cut(s) 224
MboI GATC 1 cut(s) 222
MboII GAAGA 1 cut(s) 28
MhlI GDGCHC 2 cut(s) 53, 298
MlsI TGGCCA 2 cut(s) 509, 522
MluCI AATT 3 cut(s) 322, 437, 544
MluNI TGGCCA 2 cut(s) 509, 522
MnlI CCTC 3 cut(s) 159, 192, 551
Mox20I TGGCCA 2 cut(s) 509, 522
MscI TGGCCA 2 cut(s) 509, 522
MslI CAYNNNNRTG 1 cut(s) 365
Msp20I TGGCCA 2 cut(s) 509, 522
MspR9I CCNGG 1 cut(s) 159
MvaI CCWGG 1 cut(s) 159
NcoI CCATGG 2 cut(s) 11, 504
NdeII GATC 1 cut(s) 222
NlaIII CATG 7 cut(s) 15, 59, 188, 307, 349, 462, 508
NlaIV GGNNCC 2 cut(s) 73, 414
PagI TCATGA 1 cut(s) 184
PfeI GAWTC 2 cut(s) 308, 349
Ppu21I YACGTR 1 cut(s) 478
Psp6I CCWGG 1 cut(s) 157
PspGI CCWGG 1 cut(s) 157
PspN4I GGNNCC 2 cut(s) 73, 414
RsaI GTAC 2 cut(s) 176, 191
RsaNI GTAC 2 cut(s) 175, 190
RseI CAYNNNNRTG 1 cut(s) 365
Sau3AI GATC 1 cut(s) 222
ScrFI CCNGG 1 cut(s) 159
SduI GDGCHC 2 cut(s) 53, 298
SexAI ACCWGGT 1 cut(s) 157
SfaNI GCATC 2 cut(s) 232, 478
SfcI CTRYAG 1 cut(s) 387
SmiMI CAYNNNNRTG 1 cut(s) 365
SnaBI TACGTA 1 cut(s) 478
Sse9I AATT 3 cut(s) 322, 437, 544
SsiI CCGC 2 cut(s) 169, 239
SspI AATATT 1 cut(s) 339
SspMI CTAG 1 cut(s) 299
StyD4I CCNGG 1 cut(s) 157
StyI CCWWGG 3 cut(s) 11, 75, 504
TaaI ACNGT 1 cut(s) 391
TaiI ACGT 4 cut(s) 195, 254, 480, 515
TasI AATT 3 cut(s) 322, 437, 544
TfiI GAWTC 2 cut(s) 308, 349
TspDTI ATGAA 3 cut(s) 142, 362, 447
XcmI CCANNNNNNNNNTGG 1 cut(s) 73
XmiI GTMKAC 1 cut(s) 400
XspI CTAG 1 cut(s) 299
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.