Rmu_sc0018759.1_g000001

sodium-coupled neutral amino acid transporter

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0018759.1
OG0000616
Physical Location & Seq
Reverse (-)
296 .. 1302
1007 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0018759.1_g000001.1.cds

Sequence Viewer

Length: 600 bp
atgtacttgattgcagttcaccctattgagaacgagctagtagaccctaaccagatgaagtcaatagtacgaacatcacttacattttgctcatctgtgtacgttgcgaccagcttctttggtgttcttctctttggggatcaaacactggatgatgtactggcaaattttgatggtgatcttggaattccatatagctcatttcttgatgatattgttagagtgagctatggcctccacctgatgcttgttttcccaattgtatttttctcccttcgcctcaatttggacgggcttctctttccctatgccattcctattgcctttgacaaccgaagattctactcagtaacagcagcactgatgggttttatcttttcgggagccaattttattcccagtatctgggatgcctttcagttcacaggtgctactgctgcgatctcggttggtttcatatttccagctgccgttgccctcagggatgctcatggaattgcaacaaagaaggacagactaatatcatgggtgatgatccttttagcagtctcttccagcacagtggccatctctagtgacatttacagcttttttttgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04724 ko04727 ko04974 map04724 map04727 map04974
Pfam Domains
Protein Families
Aa_trans

Protein Analysis

199

Amino Acids

21.94

Weight (kDa)

4.73

Isoelectric Point (pI)

23.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000616)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G30390 AT3G30390 AT3G30390 AT5G38820 AT5G38820 AT5G38820
fragaria_vesca FvH4_2g32550 FvH4_2g32550 FvH4_2g32550 FvH4_2g32550 FvH4_2g32550 FvH4_2g32550 FvH4_2g32550 FvH4_4g28960 FvH4_6g46060 FvH4_6g46060 FvH4_6g46080
malus_domestica MD09G1077200.v1.1 MD09G1077400.v1.1 MD15G1064300.v1.1 MD16G1053900.v1.1 MD17G1067600.v1.1 MD17G1067800.v1.1
prunus_persica Prupe.1G295800_v2.0.a1 Prupe.1G295800_v2.0.a1 Prupe.1G295800_v2.0.a1 Prupe.1G418300_v2.0.a1 Prupe.3G246600_v2.0.a1 Prupe.3G246800_v2.0.a1 Prupe.3G246900_v2.0.a1
pyrus_communis pycom09g00430 pycom09g00450 pycom15g06100 pycom16g04690 pycom17g06820
rosa_chinensis RchiOBHm_Chr2g0164381 RchiOBHm_Chr2g0164401 RchiOBHm_Chr4g0437101 RchiOBHm_Chr6g0310121
rosa_laevigata RLG00000006468 RLG00000010508 RLG00000021456 RLG00000021458
rosa_multiflora Rmu_co8348867.1_g000001 Rmu_sc0000294.1_g000029 Rmu_sc0009487.1_g000003 Rmu_sc0018759.1_g000001 Rmu_sc0021401.1_g000003 Rmu_ssc0000006.1_g000009
rosa_roxburghii Rroxscaffold_2G00086590 Rroxscaffold_2G00086610 Rroxscaffold_5G00378170 Rroxscaffold_7G00158840
rosa_rugosa Rorug02G0508200 Rorug02G0508300 Rorug04G0298000 Rorug06G0377600
rosa_samantha Rh2AG576200 Rh2AG576400 Rh2BG587200 Rh2BG587400 Rh2CG558000 Rh2CG558200 Rh2DG596900 Rh2DG597200 Rh4AG352800 Rh4BG362300 Rh4CG376500 Rh4DG356300 Rh6AG491600 Rh6BG501000 Rh6CG506000 Rh6DG492100
rosa_wichuraiana Rw2G047720 Rw2G047740 Rw2G047820 Rw2G047840 Rw4G030890 Rw6G042770

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 405
AccI GTMKAC 1 cut(s) 42
AclWI GGATC 2 cut(s) 147, 529
AcoI YGGCCR 1 cut(s) 564
AcsI RAATTY 2 cut(s) 166, 186
AfaI GTAC 4 cut(s) 5, 69, 101, 159
AfiI CCNNNNNNNGG 2 cut(s) 286, 405
AluBI AGCT 6 cut(s) 37, 114, 198, 228, 467, 588
AluI AGCT 6 cut(s) 37, 114, 198, 228, 467, 588
Alw26I GTCTC 1 cut(s) 553
AlwI GGATC 2 cut(s) 147, 529
AlwNI CAGNNNCTG 1 cut(s) 405
AoxI GGCC 2 cut(s) 232, 564
ApeKI GCWGC 3 cut(s) 356, 437, 467
ApoI RAATTY 2 cut(s) 166, 186
AsuHPI GGTGA 3 cut(s) 11, 188, 541
AxyI CCTNAGG 1 cut(s) 479
BalI TGGCCA 1 cut(s) 566
BbvI GCAGC 3 cut(s) 368, 424, 454
BccI CCATC 3 cut(s) 167, 358, 575
BceAI ACGGC 1 cut(s) 455
BcoDI GTCTC 1 cut(s) 553
BfaI CTAG 2 cut(s) 38, 573
BisI GCNGC 3 cut(s) 357, 438, 468
BlsI GCNGC 3 cut(s) 358, 439, 469
BmiI GGNNCC 1 cut(s) 385
BmrI ACTGGG 1 cut(s) 393
BmsI GCATC 3 cut(s) 234, 400, 475
BmuI ACTGGG 1 cut(s) 393
BsaBI GATNNNNATC 1 cut(s) 177
Bsc4I CCNNNNNNNGG 2 cut(s) 286, 405
Bse1I ACTGG 3 cut(s) 153, 165, 399
Bse21I CCTNAGG 1 cut(s) 479
Bse8I GATNNNNATC 1 cut(s) 177
BseGI GGATG 3 cut(s) 157, 415, 490
BseJI GATNNNNATC 1 cut(s) 177
BseLI CCNNNNNNNGG 2 cut(s) 286, 405
BseMII CTCAG 2 cut(s) 360, 493
BseNI ACTGG 3 cut(s) 153, 165, 399
BseXI GCAGC 3 cut(s) 368, 424, 454
BshFI GGCC 2 cut(s) 234, 566
BslI CCNNNNNNNGG 2 cut(s) 286, 405
BsmAI GTCTC 1 cut(s) 553
BsnI GGCC 2 cut(s) 234, 566
Bsp143I GATC 4 cut(s) 139, 178, 441, 534
BspANI GGCC 2 cut(s) 234, 566
BspCNI CTCAG 2 cut(s) 359, 492
BspLI GGNNCC 1 cut(s) 385
BspPI GGATC 2 cut(s) 147, 529
BsrI ACTGG 3 cut(s) 153, 165, 399
BssMI GATC 4 cut(s) 139, 178, 441, 534
Bst4CI ACNGT 1 cut(s) 562
Bst6I CTCTTC 1 cut(s) 556
BstDEI CTNAG 2 cut(s) 346, 479
BstF5I GGATG 3 cut(s) 157, 415, 490
BstKTI GATC 4 cut(s) 142, 181, 444, 537
BstMAI GTCTC 1 cut(s) 553
BstMBI GATC 4 cut(s) 139, 178, 441, 534
BstMWI GCNNNNNNNGC 2 cut(s) 437, 473
BstV1I GCAGC 3 cut(s) 368, 424, 454
BstXI CCANNNNNNTGG 1 cut(s) 562
Bsu36I CCTNAGG 1 cut(s) 479
BsuRI GGCC 2 cut(s) 234, 566
BtsCI GGATG 3 cut(s) 157, 415, 490
BtsIMutI CAGTG 3 cut(s) 146, 359, 567
CaiI CAGNNNCTG 1 cut(s) 405
Csp6I GTAC 4 cut(s) 4, 68, 100, 158
CviAII CATG 2 cut(s) 491, 525
CviQI GTAC 4 cut(s) 4, 68, 100, 158
DdeI CTNAG 2 cut(s) 346, 479
DpnI GATC 4 cut(s) 141, 180, 443, 536
DpnII GATC 4 cut(s) 139, 178, 441, 534
EaeI YGGCCR 1 cut(s) 564
Eam1104I CTCTTC 1 cut(s) 556
EarI CTCTTC 1 cut(s) 556
Eco81I CCTNAGG 1 cut(s) 479
EcoRI GAATTC 1 cut(s) 186
FaeI CATG 2 cut(s) 494, 528
FaiI YATR 7 cut(s) 193, 195, 231, 309, 458, 492, 526
FatI CATG 2 cut(s) 490, 524
FblI GTMKAC 1 cut(s) 42
Fnu4HI GCNGC 3 cut(s) 357, 438, 468
FokI GGATG 3 cut(s) 164, 422, 497
Fsp4HI GCNGC 3 cut(s) 357, 438, 468
FspBI CTAG 2 cut(s) 38, 573
GluI GCNGC 3 cut(s) 357, 438, 468
HaeIII GGCC 2 cut(s) 234, 566
Hin1II CATG 2 cut(s) 494, 528
HinfI GANTC 1 cut(s) 339
HphI GGTGA 3 cut(s) 11, 188, 541
Hpy166II GTNNAC 4 cut(s) 19, 43, 100, 423
Hpy188III TCNNGA 2 cut(s) 206, 381
Hpy8I GTNNAC 4 cut(s) 19, 43, 100, 423
HpyAV CCTTC 2 cut(s) 284, 502
HpyCH4III ACNGT 1 cut(s) 562
HpyCH4IV ACGT 1 cut(s) 102
HpyCH4V TGCA 2 cut(s) 14, 500
HpyF10VI GCNNNNNNNGC 2 cut(s) 437, 473
HpyF3I CTNAG 2 cut(s) 346, 479
HpySE526I ACGT 1 cut(s) 102
Hsp92II CATG 2 cut(s) 494, 528
Kzo9I GATC 4 cut(s) 139, 178, 441, 534
LmnI GCTCC 1 cut(s) 383
Lsp1109I GCAGC 3 cut(s) 368, 424, 454
LweI GCATC 3 cut(s) 234, 400, 475
MaeI CTAG 2 cut(s) 38, 573
MaeII ACGT 1 cut(s) 102
MaeIII GTNAC 2 cut(s) 349, 575
MalI GATC 4 cut(s) 141, 180, 443, 536
MboI GATC 4 cut(s) 139, 178, 441, 534
MboII GAAGA 3 cut(s) 119, 348, 543
MfeI CAATTG 1 cut(s) 258
MlsI TGGCCA 1 cut(s) 566
MluCI AATT 6 cut(s) 166, 186, 258, 283, 388, 495
MluNI TGGCCA 1 cut(s) 566
MnlI CCTC 3 cut(s) 245, 290, 488
Mox20I TGGCCA 1 cut(s) 566
MscI TGGCCA 1 cut(s) 566
Msp20I TGGCCA 1 cut(s) 566
MspA1I CMGCKG 1 cut(s) 467
MunI CAATTG 1 cut(s) 258
MwoI GCNNNNNNNGC 2 cut(s) 437, 473
NdeII GATC 4 cut(s) 139, 178, 441, 534
NlaIII CATG 2 cut(s) 494, 528
NlaIV GGNNCC 1 cut(s) 385
NmuCI GTSAC 1 cut(s) 575
PfeI GAWTC 1 cut(s) 339
PflMI CCANNNNNTGG 1 cut(s) 405
PkrI GCNGC 3 cut(s) 358, 439, 469
PspN4I GGNNCC 1 cut(s) 385
PsrI GAACNNNNNNTAC 2 cut(s) 64, 96
PstNI CAGNNNCTG 1 cut(s) 405
PvuII CAGCTG 1 cut(s) 467
RsaI GTAC 4 cut(s) 5, 69, 101, 159
RsaNI GTAC 4 cut(s) 4, 68, 100, 158
SatI GCNGC 3 cut(s) 357, 438, 468
Sau3AI GATC 4 cut(s) 139, 178, 441, 534
SetI ASST 9 cut(s) 39, 105, 116, 200, 230, 243, 430, 469, 590
SfaNI GCATC 3 cut(s) 234, 400, 475
Sse9I AATT 6 cut(s) 166, 186, 258, 283, 388, 495
SspMI CTAG 2 cut(s) 38, 573
TaaI ACNGT 1 cut(s) 562
TaiI ACGT 1 cut(s) 105
TasI AATT 6 cut(s) 166, 186, 258, 283, 388, 495
TatI WGTACW 2 cut(s) 3, 157
TfiI GAWTC 1 cut(s) 339
TscAI CASTG 3 cut(s) 153, 366, 567
TseFI GTSAC 1 cut(s) 575
TseI GCWGC 3 cut(s) 356, 437, 467
Tsp45I GTSAC 1 cut(s) 575
TspDTI ATGAA 2 cut(s) 71, 445
TspRI CASTG 3 cut(s) 153, 366, 567
Van91I CCANNNNNTGG 1 cut(s) 405
XapI RAATTY 2 cut(s) 166, 186
XmiI GTMKAC 1 cut(s) 42
XspI CTAG 2 cut(s) 38, 573
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.