Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0035138.1

Orthogroup ID

OG0003283

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 259

Gene Structure 259 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0035138.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 259 bp

tatcagaatcattgataaaacctcctgcgattccggtggcctcgggttgagcctcgacgatggcgctgacgagagagagagaggagacagagagacggatttcggtggccttggattgagcttcaacgtcgacgtcgacgacgacgctgacgagagagaagagagagagaacgacgctgaggagagagagaagagaagagacgacgcggaggagagaggagacgagaggagagagagagatgagagtggcaggctgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

85

Amino Acids

9.69

Weight (kDa)

4.25

Isoelectric Point (pI)

40.93

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003283)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0143551 RchiOBHm_Chr2g0158851 RchiOBHm_Chr4g0405391 RchiOBHm_Chr5g0042021 RchiOBHm_Chr7g0239361
rosa_laevigata	RLG00000000606 RLG00000009319 RLG00000011277 RLG00000012176 RLG00000014078 RLG00000016406 RLG00000018993 RLG00000025221
rosa_multiflora	Rmu_sc0000060.1_g000051 Rmu_sc0002267.1_g000016 Rmu_sc0006065.1_g000016 Rmu_sc0006536.1_g000022 Rmu_sc0009140.1_g000005 Rmu_sc0011904.1_g000019 Rmu_sc0011904.1_g000020 Rmu_sc0035138.1_g000001 Rmu_ssc0000215.1_g000052
rosa_roxburghii	Rroxscaffold_1G00020140 Rroxscaffold_1G00047550 Rroxscaffold_3G00264810 Rroxscaffold_7G00190020
rosa_rugosa	Rorug01G0136000.1 Rorug05G0555800 Rorug06G0419400 Rorug07G0345100
rosa_samantha	Rh2BG229200 Rh2CG407900 Rh4AG189500 Rh4AG387700 Rh4BG155500 Rh5BG091100 Rh7AG143300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	136
AccI	GTMKAC	2 cut(s)	130, 136
AccII	CGCG	1 cut(s)	207
AciI	CCGC	1 cut(s)	207
AcyI	GRCGYC	1 cut(s)	133
AgsI	TTSAA	1 cut(s)	125
AluBI	AGCT	1 cut(s)	121
AluI	AGCT	1 cut(s)	121
Alw26I	GTCTC	4 cut(s)	79, 87, 193, 214
Ama87I	CYCGRG	1 cut(s)	42
AoxI	GGCC	2 cut(s)	38, 107
AspLEI	GCGC	1 cut(s)	66
AvaI	CYCGRG	1 cut(s)	42
BbvCI	CCTCAGC	1 cut(s)	178
BccI	CCATC	1 cut(s)	54
BcoDI	GTCTC	4 cut(s)	79, 87, 193, 214
BfmI	CTRYAG	1 cut(s)	255
BfoI	RGCGCY	1 cut(s)	67
BmeT110I	CYCGRG	1 cut(s)	42
Bpu10I	CCTNAGC	1 cut(s)	178
BsaHI	GRCGYC	1 cut(s)	133
BsaJI	CCNNGG	2 cut(s)	41, 110
BsaWI	WCCGGW	1 cut(s)	33
BseDI	CCNNGG	2 cut(s)	41, 110
BseMII	CTCAG	1 cut(s)	169
BseRI	GAGGAG	5 cut(s)	97, 195, 225, 232, 242
Bsh1236I	CGCG	1 cut(s)	207
BshFI	GGCC	2 cut(s)	40, 109
BsiHKCI	CYCGRG	1 cut(s)	42
BsiSI	CCGG	1 cut(s)	34
BsmAI	GTCTC	4 cut(s)	79, 87, 193, 214
BsmBI	CGTCTC	3 cut(s)	87, 193, 214
BsnI	GGCC	2 cut(s)	40, 109
BsoBI	CYCGRG	1 cut(s)	42
BspACI	CCGC	1 cut(s)	207
BspANI	GGCC	2 cut(s)	40, 109
BspCNI	CTCAG	1 cut(s)	170
BspFNI	CGCG	1 cut(s)	207
BssECI	CCNNGG	2 cut(s)	41, 110
BssNI	GRCGYC	1 cut(s)	133
BssT1I	CCWWGG	1 cut(s)	110
Bst6I	CTCTTC	3 cut(s)	154, 186, 191
BstACI	GRCGYC	1 cut(s)	133
BstC8I	GCNNGC	1 cut(s)	252
BstDEI	CTNAG	1 cut(s)	178
BstFNI	CGCG	1 cut(s)	207
BstH2I	RGCGCY	1 cut(s)	67
BstHHI	GCGC	1 cut(s)	66
BstMAI	GTCTC	4 cut(s)	79, 87, 193, 214
BstSFI	CTRYAG	1 cut(s)	255
BstUI	CGCG	1 cut(s)	207
BsuRI	GGCC	2 cut(s)	40, 109
Cac8I	GCNNGC	1 cut(s)	252
CfoI	GCGC	1 cut(s)	66
CseI	GACGC	3 cut(s)	153, 183, 213
CviJI	RGCY	5 cut(s)	40, 52, 109, 121, 254
CviKI_1	RGCY	5 cut(s)	40, 52, 109, 121, 254
DdeI	CTNAG	1 cut(s)	178
Eam1104I	CTCTTC	3 cut(s)	154, 186, 191
EarI	CTCTTC	3 cut(s)	154, 186, 191
Eco130I	CCWWGG	1 cut(s)	110
Eco88I	CYCGRG	1 cut(s)	42
EcoT14I	CCWWGG	1 cut(s)	110
ErhI	CCWWGG	1 cut(s)	110
Esp3I	CGTCTC	3 cut(s)	87, 193, 214
FblI	GTMKAC	2 cut(s)	130, 136
GlaI	GCGC	1 cut(s)	65
HaeII	RGCGCY	1 cut(s)	67
HaeIII	GGCC	2 cut(s)	40, 109
HapII	CCGG	1 cut(s)	34
HgaI	GACGC	3 cut(s)	153, 183, 213
HhaI	GCGC	1 cut(s)	66
Hin1I	GRCGYC	1 cut(s)	133
Hin6I	GCGC	1 cut(s)	64
HinP1I	GCGC	1 cut(s)	64
HincII	GTYRAC	2 cut(s)	131, 137
HindII	GTYRAC	2 cut(s)	131, 137
HinfI	GANTC	2 cut(s)	7, 30
HpaII	CCGG	1 cut(s)	34
Hpy166II	GTNNAC	2 cut(s)	131, 137
Hpy188I	TCNGA	1 cut(s)	6
Hpy8I	GTNNAC	2 cut(s)	131, 137
Hpy99I	CGWCG	9 cut(s)	60, 132, 135, 138, 141, 144, 147, 177, 207
HpyCH4IV	ACGT	2 cut(s)	127, 133
HpyF3I	CTNAG	1 cut(s)	178
HpySE526I	ACGT	2 cut(s)	127, 133
Hsp92I	GRCGYC	1 cut(s)	133
HspAI	GCGC	1 cut(s)	64
LpnPI	CCDG	3 cut(s)	38, 47, 236
MaeII	ACGT	2 cut(s)	127, 133
MboII	GAAGA	3 cut(s)	171, 203, 208
MnlI	CCTC	8 cut(s)	32, 51, 63, 75, 173, 203, 210, 220
MspI	CCGG	1 cut(s)	34
MvnI	CGCG	1 cut(s)	207
PcsI	WCGNNNNNNNCGW	4 cut(s)	133, 136, 139, 148
PfeI	GAWTC	2 cut(s)	7, 30
SalI	GTCGAC	2 cut(s)	129, 135
SetI	ASST	4 cut(s)	24, 123, 130, 136
SfcI	CTRYAG	1 cut(s)	255
SgrDI	CGTCGACG	2 cut(s)	129, 135
SsiI	CCGC	1 cut(s)	207
StyI	CCWWGG	1 cut(s)	110
TaiI	ACGT	2 cut(s)	130, 136
TaqI	TCGA	3 cut(s)	55, 130, 136
TfiI	GAWTC	2 cut(s)	7, 30
TspGWI	ACGGA	1 cut(s)	111
XmiI	GTMKAC	2 cut(s)	130, 136
ZraI	GACGTC	1 cut(s)	134

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.