Rroxscaffold_1G00047550

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0003283
Physical Location & Seq
Forward (+)
67154148 .. 67155488
1341 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00047550.1

Sequence Viewer

Length: 207 bp
ATGAAAAGAGGAGGAGGAGGAGGAAGGAGAAAAGATCAATGGCATTGGCGCTCCTATCGAAGTGAATTGGACAAGGATGATGATTTGGTCAAGAAGGTTCTAGAACAAGAGCCCGAGATGCTCGCCACGCATCCGCATCGCCGTTCTCGCTCGGCTAACTGGTTGTATTGGATATTTGGATTGAAGCTTTCGTGGATTGAAGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

8.27

Weight (kDa)

9.52

Isoelectric Point (pI)

84.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 134
AgsI TTSAA 2 cut(s) 184, 200
AluBI AGCT 1 cut(s) 187
AluI AGCT 1 cut(s) 187
Ama87I CYCGRG 1 cut(s) 113
AspLEI GCGC 1 cut(s) 51
AvaI CYCGRG 1 cut(s) 113
BanII GRGCYC 1 cut(s) 114
BceAI ACGGC 1 cut(s) 126
BcgI CGANNNNNNTGC 2 cut(s) 119, 153
BfaI CTAG 1 cut(s) 101
BfoI RGCGCY 1 cut(s) 52
BmeT110I CYCGRG 1 cut(s) 113
BmsI GCATC 3 cut(s) 108, 139, 145
Bse1I ACTGG 1 cut(s) 164
BseGI GGATG 2 cut(s) 82, 130
BseNI ACTGG 1 cut(s) 164
BseRI GAGGAG 4 cut(s) 24, 27, 30, 33
BsiHKCI CYCGRG 1 cut(s) 113
BsoBI CYCGRG 1 cut(s) 113
Bsp1286I GDGCHC 1 cut(s) 114
Bsp143I GATC 1 cut(s) 34
BspACI CCGC 1 cut(s) 134
BsrI ACTGG 1 cut(s) 164
BssMI GATC 1 cut(s) 34
BstC8I GCNNGC 1 cut(s) 123
BstF5I GGATG 2 cut(s) 82, 130
BstH2I RGCGCY 1 cut(s) 52
BstHHI GCGC 1 cut(s) 51
BstKTI GATC 1 cut(s) 37
BstMBI GATC 1 cut(s) 34
BstMWI GCNNNNNNNGC 3 cut(s) 118, 127, 147
BtgZI GCGATG 1 cut(s) 122
BtsCI GGATG 2 cut(s) 82, 130
Cac8I GCNNGC 1 cut(s) 123
CfoI GCGC 1 cut(s) 51
CviJI RGCY 3 cut(s) 112, 155, 187
CviKI_1 RGCY 3 cut(s) 112, 155, 187
DpnI GATC 1 cut(s) 36
DpnII GATC 1 cut(s) 34
Eco24I GRGCYC 1 cut(s) 114
Eco88I CYCGRG 1 cut(s) 113
EcoT38I GRGCYC 1 cut(s) 114
FokI GGATG 2 cut(s) 89, 117
FriOI GRGCYC 1 cut(s) 114
FspBI CTAG 1 cut(s) 101
GlaI GCGC 1 cut(s) 50
HaeII RGCGCY 1 cut(s) 52
HhaI GCGC 1 cut(s) 51
Hin6I GCGC 1 cut(s) 49
HinP1I GCGC 1 cut(s) 49
HindIII AAGCTT 1 cut(s) 185
Hpy188III TCNNGA 2 cut(s) 91, 101
HpyAV CCTTC 2 cut(s) 18, 88
HpyF10VI GCNNNNNNNGC 3 cut(s) 118, 127, 147
HspAI GCGC 1 cut(s) 49
Kzo9I GATC 1 cut(s) 34
LmnI GCTCC 1 cut(s) 56
LpnPI CCDG 1 cut(s) 145
LweI GCATC 3 cut(s) 108, 139, 145
MaeI CTAG 1 cut(s) 101
MalI GATC 1 cut(s) 36
MboI GATC 1 cut(s) 34
MhlI GDGCHC 1 cut(s) 114
MluCI AATT 1 cut(s) 65
MnlI CCTC 4 cut(s) 5, 8, 11, 14
MwoI GCNNNNNNNGC 3 cut(s) 118, 127, 147
NdeII GATC 1 cut(s) 34
NmeAIII GCCGAG 1 cut(s) 131
Sau3AI GATC 1 cut(s) 34
SduI GDGCHC 1 cut(s) 114
SetI ASST 2 cut(s) 99, 189
SfaNI GCATC 3 cut(s) 108, 139, 145
Sse9I AATT 1 cut(s) 65
SsiI CCGC 1 cut(s) 134
SspMI CTAG 1 cut(s) 101
TaqI TCGA 1 cut(s) 58
TasI AATT 1 cut(s) 65
TspDTI ATGAA 1 cut(s) 17
XbaI TCTAGA 1 cut(s) 100
XspI CTAG 1 cut(s) 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.