Rroxscaffold_1G00033430

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0001053
Physical Location & Seq
Reverse (-)
48295664 .. 48297113
1450 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00033430.1

Sequence Viewer

Length: 210 bp
ATGCATACACTGAGGTGGGCTCTGCCTTCAATTATGCAGTCAGACTTTAAGTTTCTACGGTGGCCAGAGCAACCAACAAAGCTAAGTCTCACCCCTCATTCTATCTTCTTATTGAGCTTTTATAGAAACACCACATGCCTAGACTTTGCACCACTAGTCAATGATAATTCCTCAAGCATGAGCCCATTGTTTATCAATAATCTGGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

8.03

Weight (kDa)

7.98

Isoelectric Point (pI)

77.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 62
AgsI TTSAA 1 cut(s) 30
AhlI ACTAGT 1 cut(s) 154
AleI CACNNNNGTG 1 cut(s) 13
AluBI AGCT 2 cut(s) 82, 117
AluI AGCT 2 cut(s) 82, 117
Alw26I GTCTC 1 cut(s) 92
AoxI GGCC 1 cut(s) 62
AsuHPI GGTGA 1 cut(s) 82
BalI TGGCCA 1 cut(s) 64
BanII GRGCYC 2 cut(s) 22, 185
BcoDI GTCTC 1 cut(s) 92
BcuI ACTAGT 1 cut(s) 154
BfaI CTAG 2 cut(s) 140, 155
BplI GAGNNNNNCTC 1 cut(s) 36
BpuEI CTTGAG 1 cut(s) 157
BshFI GGCC 1 cut(s) 64
BsmAI GTCTC 1 cut(s) 92
BsnI GGCC 1 cut(s) 64
Bsp1286I GDGCHC 2 cut(s) 22, 185
BspANI GGCC 1 cut(s) 64
Bst4CI ACNGT 1 cut(s) 60
BstDEI CTNAG 2 cut(s) 11, 83
BstMAI GTCTC 1 cut(s) 92
BstNSI RCATGY 1 cut(s) 138
BsuRI GGCC 1 cut(s) 64
BtsIMutI CAGTG 1 cut(s) 8
CviAII CATG 2 cut(s) 135, 178
CviJI RGCY 5 cut(s) 20, 64, 82, 117, 183
CviKI_1 RGCY 5 cut(s) 20, 64, 82, 117, 183
DdeI CTNAG 2 cut(s) 11, 83
EaeI YGGCCR 1 cut(s) 62
Eco24I GRGCYC 2 cut(s) 22, 185
EcoT22I ATGCAT 1 cut(s) 6
EcoT38I GRGCYC 2 cut(s) 22, 185
FaeI CATG 2 cut(s) 138, 181
FaiI YATR 6 cut(s) 6, 35, 123, 136, 179, 208
FatI CATG 2 cut(s) 134, 177
FriOI GRGCYC 2 cut(s) 22, 185
FspBI CTAG 2 cut(s) 140, 155
HaeIII GGCC 1 cut(s) 64
Hin1II CATG 2 cut(s) 138, 181
HphI GGTGA 1 cut(s) 82
Hpy188I TCNGA 1 cut(s) 43
HpyAV CCTTC 1 cut(s) 36
HpyCH4III ACNGT 1 cut(s) 60
HpyCH4V TGCA 3 cut(s) 4, 37, 149
HpyF3I CTNAG 2 cut(s) 11, 83
Hsp92II CATG 2 cut(s) 138, 181
LpnPI CCDG 2 cut(s) 78, 188
MaeI CTAG 2 cut(s) 140, 155
MboII GAAGA 1 cut(s) 97
MhlI GDGCHC 2 cut(s) 22, 185
MlsI TGGCCA 1 cut(s) 64
MluCI AATT 2 cut(s) 30, 166
MluNI TGGCCA 1 cut(s) 64
MnlI CCTC 3 cut(s) 6, 105, 181
Mox20I TGGCCA 1 cut(s) 64
Mph1103I ATGCAT 1 cut(s) 6
MscI TGGCCA 1 cut(s) 64
MseI TTAA 1 cut(s) 48
MslI CAYNNNNRTG 1 cut(s) 13
Msp20I TGGCCA 1 cut(s) 64
NlaIII CATG 2 cut(s) 138, 181
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 138
OliI CACNNNNGTG 1 cut(s) 13
RseI CAYNNNNRTG 1 cut(s) 13
SaqAI TTAA 1 cut(s) 48
SduI GDGCHC 2 cut(s) 22, 185
SetI ASST 3 cut(s) 17, 84, 119
SgeI CNNG 6 cut(s) 77, 147, 152, 167, 186, 190
SmiMI CAYNNNNRTG 1 cut(s) 13
SmlI CTYRAG 1 cut(s) 172
SmoI CTYRAG 1 cut(s) 172
SpeI ACTAGT 1 cut(s) 154
Sse9I AATT 2 cut(s) 30, 166
SspMI CTAG 2 cut(s) 140, 155
TaaI ACNGT 1 cut(s) 60
TasI AATT 2 cut(s) 30, 166
Tru1I TTAA 1 cut(s) 48
Tru9I TTAA 1 cut(s) 48
TscAI CASTG 1 cut(s) 15
TspRI CASTG 1 cut(s) 15
XceI RCATGY 1 cut(s) 138
XspI CTAG 2 cut(s) 140, 155
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.