Rroxscaffold_7G00210000

Carbohydrate esterase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
60258219 .. 60260493
2275 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00210000.1

Sequence Viewer

Length: 285 bp
ATGGTTAGGCTCATTGAGAATGTGCGCCATGACCTTGCTGTGCCTTCACTTCCAATAATCCAGGTGGCTATTTGTTCTGGTGATGAGAAGTTCTTGGAGAAAATTAGGGAGGTTCAATTGGGGTTGAAGGTTGAGAATGTTGTGTGTGTGGATGCCAAGGGATTGGAGCTGAAAGATGATCATCTTCACCTGACTACCAAGGCTCAAGTTCAGTTGGGTCAGATGCTTGCTGATGCTTACCTCAAGCATTTTGGATCAGCTAATTCCCATCATCCTGCCCTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

94

Amino Acids

10.42

Weight (kDa)

6.27

Isoelectric Point (pI)

13.08

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SASA PF03629 1 - 82 2.4e-26 Carbohydrate esterase, sialic acid-specific acetylesterase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 262
AgsI TTSAA 2 cut(s) 116, 127
AjnI CCWGG 1 cut(s) 60
AluBI AGCT 2 cut(s) 169, 260
AluI AGCT 2 cut(s) 169, 260
AlwI GGATC 1 cut(s) 262
AspLEI GCGC 1 cut(s) 27
AsuHPI GGTGA 2 cut(s) 92, 179
BccI CCATC 1 cut(s) 276
BciT130I CCWGG 1 cut(s) 62
BclI TGATCA 1 cut(s) 178
Bme1390I CCNGG 1 cut(s) 62
BmrFI CCNGG 1 cut(s) 62
BmsI GCATC 3 cut(s) 142, 213, 223
BpuEI CTTGAG 2 cut(s) 189, 227
BsaBI GATNNNNATC 1 cut(s) 180
BsaJI CCNNGG 2 cut(s) 156, 198
Bse8I GATNNNNATC 1 cut(s) 180
BseBI CCWGG 1 cut(s) 62
BseDI CCNNGG 2 cut(s) 156, 198
BseGI GGATG 2 cut(s) 157, 271
BseJI GATNNNNATC 1 cut(s) 180
Bsp143I GATC 2 cut(s) 178, 254
BspPI GGATC 1 cut(s) 262
BssECI CCNNGG 2 cut(s) 156, 198
BssMI GATC 2 cut(s) 178, 254
BssT1I CCWWGG 2 cut(s) 156, 198
Bst2UI CCWGG 1 cut(s) 62
BstC8I GCNNGC 1 cut(s) 228
BstF5I GGATG 2 cut(s) 157, 271
BstHHI GCGC 1 cut(s) 27
BstKTI GATC 2 cut(s) 181, 257
BstMBI GATC 2 cut(s) 178, 254
BstNI CCWGG 1 cut(s) 62
BstSCI CCNGG 1 cut(s) 60
BstXI CCANNNNNNTGG 1 cut(s) 163
BtsCI GGATG 2 cut(s) 157, 271
Cac8I GCNNGC 1 cut(s) 228
CfoI GCGC 1 cut(s) 27
CviAII CATG 1 cut(s) 29
CviJI RGCY 5 cut(s) 10, 68, 169, 203, 260
CviKI_1 RGCY 5 cut(s) 10, 68, 169, 203, 260
DpnI GATC 2 cut(s) 180, 256
DpnII GATC 2 cut(s) 178, 254
Eco130I CCWWGG 2 cut(s) 156, 198
EcoRII CCWGG 1 cut(s) 60
EcoT14I CCWWGG 2 cut(s) 156, 198
ErhI CCWWGG 2 cut(s) 156, 198
FaeI CATG 1 cut(s) 32
FaiI YATR 1 cut(s) 30
FatI CATG 1 cut(s) 28
FbaI TGATCA 1 cut(s) 178
FokI GGATG 2 cut(s) 164, 258
GlaI GCGC 1 cut(s) 26
HhaI GCGC 1 cut(s) 27
Hin1II CATG 1 cut(s) 32
Hin6I GCGC 1 cut(s) 25
HinP1I GCGC 1 cut(s) 25
HphI GGTGA 2 cut(s) 92, 179
Hpy188I TCNGA 1 cut(s) 222
HpyAV CCTTC 2 cut(s) 54, 121
Hsp92II CATG 1 cut(s) 32
HspAI GCGC 1 cut(s) 25
Ksp22I TGATCA 1 cut(s) 178
Kzo9I GATC 2 cut(s) 178, 254
LmnI GCTCC 1 cut(s) 166
LpnPI CCDG 4 cut(s) 47, 63, 74, 203
LweI GCATC 3 cut(s) 142, 213, 223
MalI GATC 2 cut(s) 180, 256
MboI GATC 2 cut(s) 178, 254
MboII GAAGA 1 cut(s) 176
MfeI CAATTG 1 cut(s) 116
MluCI AATT 3 cut(s) 102, 116, 262
MnlI CCTC 2 cut(s) 103, 251
MspR9I CCNGG 1 cut(s) 62
MunI CAATTG 1 cut(s) 116
MvaI CCWGG 1 cut(s) 62
NdeII GATC 2 cut(s) 178, 254
NlaIII CATG 1 cut(s) 32
Psp6I CCWGG 1 cut(s) 60
PspGI CCWGG 1 cut(s) 60
Sau3AI GATC 2 cut(s) 178, 254
ScrFI CCNGG 1 cut(s) 62
SetI ASST 8 cut(s) 36, 66, 114, 132, 171, 192, 243, 262
SfaNI GCATC 3 cut(s) 142, 213, 223
SmlI CTYRAG 2 cut(s) 204, 242
SmoI CTYRAG 2 cut(s) 204, 242
Sse9I AATT 3 cut(s) 102, 116, 262
StyD4I CCNGG 1 cut(s) 60
StyI CCWWGG 2 cut(s) 156, 198
TasI AATT 3 cut(s) 102, 116, 262
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.