Rroxscaffold_7G00210010

Carbohydrate esterase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
60269367 .. 60270097
731 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00210010.1

Sequence Viewer

Length: 201 bp
ATGGAGGTTGAGAATGTTGTGTGTGTGGATGCCAAGGGATTGGAGCCGAAAGATGATCATCTTCACCGACCACCGAGGCTCAAGTTCGGTTGGGTCGGATGCTCGCCGATGCTTACCTCAAGCATTTTAGATCAGCTAATTCCCATCATCCTGCCCTTTAGAGCAAACAATGAAATTTTCTTTGATATGTCAATGCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

7.53

Weight (kDa)

5.07

Isoelectric Point (pI)

41.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 174
AluBI AGCT 1 cut(s) 136
AluI AGCT 1 cut(s) 136
ApoI RAATTY 1 cut(s) 174
AsuHPI GGTGA 1 cut(s) 56
BccI CCATC 1 cut(s) 152
BclI TGATCA 1 cut(s) 55
BmiI GGNNCC 1 cut(s) 45
BmsI GCATC 3 cut(s) 19, 89, 99
BpuEI CTTGAG 2 cut(s) 65, 103
BsaBI GATNNNNATC 1 cut(s) 57
BsaJI CCNNGG 2 cut(s) 33, 74
Bse8I GATNNNNATC 1 cut(s) 57
BseDI CCNNGG 2 cut(s) 33, 74
BseGI GGATG 3 cut(s) 34, 104, 147
BseJI GATNNNNATC 1 cut(s) 57
Bsp143I GATC 2 cut(s) 55, 130
BspLI GGNNCC 1 cut(s) 45
BssECI CCNNGG 2 cut(s) 33, 74
BssMI GATC 2 cut(s) 55, 130
BssT1I CCWWGG 1 cut(s) 33
BstC8I GCNNGC 1 cut(s) 104
BstF5I GGATG 3 cut(s) 34, 104, 147
BstKTI GATC 2 cut(s) 58, 133
BstMBI GATC 2 cut(s) 55, 130
BstXI CCANNNNNNTGG 1 cut(s) 40
BtsCI GGATG 3 cut(s) 34, 104, 147
Cac8I GCNNGC 1 cut(s) 104
CviJI RGCY 3 cut(s) 46, 79, 136
CviKI_1 RGCY 3 cut(s) 46, 79, 136
DpnI GATC 2 cut(s) 57, 132
DpnII GATC 2 cut(s) 55, 130
Eco130I CCWWGG 1 cut(s) 33
EcoT14I CCWWGG 1 cut(s) 33
ErhI CCWWGG 1 cut(s) 33
FaiI YATR 1 cut(s) 188
FbaI TGATCA 1 cut(s) 55
FokI GGATG 3 cut(s) 41, 111, 134
HphI GGTGA 1 cut(s) 56
Hpy188I TCNGA 1 cut(s) 98
Ksp22I TGATCA 1 cut(s) 55
Kzo9I GATC 2 cut(s) 55, 130
LmnI GCTCC 1 cut(s) 43
LpnPI CCDG 1 cut(s) 164
LweI GCATC 3 cut(s) 19, 89, 99
MalI GATC 2 cut(s) 57, 132
MboI GATC 2 cut(s) 55, 130
MboII GAAGA 1 cut(s) 53
MluCI AATT 2 cut(s) 138, 174
MmeI TCCRAC 1 cut(s) 76
MnlI CCTC 2 cut(s) 69, 127
NdeII GATC 2 cut(s) 55, 130
NlaIV GGNNCC 1 cut(s) 45
PspN4I GGNNCC 1 cut(s) 45
Sau3AI GATC 2 cut(s) 55, 130
SetI ASST 3 cut(s) 9, 119, 138
SfaNI GCATC 3 cut(s) 19, 89, 99
SgeI CNNG 6 cut(s) 46, 87, 94, 115, 132, 163
SmlI CTYRAG 2 cut(s) 80, 118
SmoI CTYRAG 2 cut(s) 80, 118
Sse9I AATT 2 cut(s) 138, 174
StyI CCWWGG 1 cut(s) 33
TasI AATT 2 cut(s) 138, 174
TspDTI ATGAA 1 cut(s) 186
XapI RAATTY 1 cut(s) 174
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.