Basic Information

Type: gene

Biological Identity

Species

rosa_rugosa

Chromosome

GWHBQTZ00000001

Orthogroup ID

OG0001142

Physical Location & Seq

Genomic Coordinates Reverse (-)

46188285 .. 46188764

Gene Structure 480 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rorug01G0343700.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 480 bp

ATGGATGGCATGGATCCGAAATATGTGAACAATCCTTGGACAAAGCATGGTGAACGTTTACCAGTTGCAGTTGATCCTAATTTGCCAGGATCTTCAGAACCTCAACCAGATTTTAATCCATCAGGACCATCATCATCTCAGCCAAATTTTGATGTGCAAGATATGTTGCATGATATATTTGGCGTGTATGAAGAAGAAGATAATTGGGAAGCACCAGGACCTACTGAAGGTCCATCCATGCCCCATGGCCCTAGCCCATATGTAGAAAGATTCTACCGGCTTATAGATGATGCTGATACTGAATTATACCCGGGTGCAGGGAAGAAGATGTTTGATTTCCTGATAAAGTTGTATCAGTTAAAAGCATTGCATAGTTGGAGTGATTTGTCGTTCACAAAGTTGCTTGAATTGTTAAAAGCCTATTTGCCTCCGGGGAAAACTCTTCCTGCTACGTTTTATTTGACAAAAAAAATTTATTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

159

Amino Acids

17.99

Weight (kDa)

4.78

Isoelectric Point (pI)

43.57

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001142)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G08440 AT5G08440 AT5G08440 AT5G23490 AT5G23490 AT5G23490 AT5G23490 AT5G23510 AT5G23510 AT5G23510
fragaria_vesca	FvH4_1g25960 FvH4_1g25960 FvH4_1g25960 FvH4_1g25960 FvH4_1g25960 FvH4_1g25960 FvH4_3g21410 FvH4_7g23540
malus_domestica	MD03G1185400.v1.1 MD04G1186900.v1.1 MD11G1230900.v1.1
prunus_persica	Prupe.4G196300_v2.0.a1 Prupe.4G288600_v2.0.a1 Prupe.4G288600_v2.0.a1 Prupe.4G288600_v2.0.a1 Prupe.4G288600_v2.0.a1 Prupe.4G288600_v2.0.a1 Prupe.4G288600_v2.0.a1 Prupe.4G288600_v2.0.a1 Prupe.4G288600_v2.0.a1 Prupe.4G288600_v2.0.a1
pyrus_communis	pycom03g16520 pycom03g16530
rosa_chinensis	RchiOBHm_Chr1g0368691 RchiOBHm_Chr3g0485101 RchiOBHm_Chr5g0036791
rosa_laevigata	RLG00000023166 RLG00000027197 RLG00000033721
rosa_multiflora	Rmu_co8159396.1_g000001 Rmu_sc0000399.1_g000002 Rmu_sc0006040.1_g000006 Rmu_sc0006040.1_g000007
rosa_roxburghii	Rroxscaffold_1G00044160 Rroxscaffold_4G00288350 Rroxscaffold_6G00397190
rosa_rugosa	Rorug01G0343700 Rorug03G0216200 Rorug03G0216300
rosa_samantha	Rh3AG266300 Rh3BG301700 Rh3CG300000 Rh3DG295800 Rh5AG250300 Rh5BG252000 Rh5CG284000 Rh5DG260300
rosa_wichuraiana	Rw5G023020

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclI	AACGTT	1 cut(s)	55
AclWI	GGATC	4 cut(s)	8, 21, 68, 97
AcsI	RAATTY	2 cut(s)	145, 471
AcuI	CTGAAG	2 cut(s)	78, 246
AfiI	CCNNNNNNNGG	2 cut(s)	227, 317
AgsI	TTSAA	1 cut(s)	407
AjnI	CCWGG	2 cut(s)	85, 214
AlwI	GGATC	4 cut(s)	8, 21, 68, 97
Ama87I	CYCGRG	1 cut(s)	310
AoxI	GGCC	1 cut(s)	247
ApoI	RAATTY	2 cut(s)	145, 471
AspS9I	GGNCC	4 cut(s)	125, 218, 230, 248
AsuC2I	CCSGG	3 cut(s)	311, 312, 432
AsuHPI	GGTGA	1 cut(s)	62
AvaI	CYCGRG	1 cut(s)	310
AvaII	GGWCC	3 cut(s)	125, 218, 230
BamHI	GGATCC	1 cut(s)	13
BccI	CCATC	3 cut(s)	127, 136, 241
BciT130I	CCWGG	2 cut(s)	87, 216
BcnI	CCSGG	3 cut(s)	311, 312, 432
BfaI	CTAG	1 cut(s)	252
Bme1390I	CCNGG	5 cut(s)	87, 216, 311, 312, 432
Bme18I	GGWCC	3 cut(s)	125, 218, 230
BmeT110I	CYCGRG	1 cut(s)	310
BmgT120I	GGNCC	4 cut(s)	125, 218, 230, 248
BmiI	GGNNCC	1 cut(s)	15
BmrFI	CCNGG	5 cut(s)	87, 216, 311, 312, 432
BmsI	GCATC	1 cut(s)	280
BpuMI	CCSGG	3 cut(s)	311, 312, 432
BsaBI	GATNNNNATC	1 cut(s)	114
BsaJI	CCNNGG	4 cut(s)	35, 244, 310, 431
Bsc4I	CCNNNNNNNGG	2 cut(s)	227, 317
Bse118I	RCCGGY	1 cut(s)	276
Bse1I	ACTGG	1 cut(s)	62
Bse3DI	GCAATG	1 cut(s)	365
Bse8I	GATNNNNATC	1 cut(s)	114
BseBI	CCWGG	2 cut(s)	87, 216
BseDI	CCNNGG	4 cut(s)	35, 244, 310, 431
BseGI	GGATG	2 cut(s)	10, 233
BseJI	GATNNNNATC	1 cut(s)	114
BseLI	CCNNNNNNNGG	2 cut(s)	227, 317
BseMI	GCAATG	1 cut(s)	365
BseMII	CTCAG	1 cut(s)	152
BseNI	ACTGG	1 cut(s)	62
BsgI	GTGCAG	1 cut(s)	336
BshFI	GGCC	1 cut(s)	249
BsiHKCI	CYCGRG	1 cut(s)	310
BsiSI	CCGG	3 cut(s)	277, 311, 431
BslI	CCNNNNNNNGG	2 cut(s)	227, 317
BsnI	GGCC	1 cut(s)	249
BsoBI	CYCGRG	1 cut(s)	310
Bsp143I	GATC	3 cut(s)	13, 73, 89
Bsp19I	CCATGG	1 cut(s)	244
BspANI	GGCC	1 cut(s)	249
BspCNI	CTCAG	1 cut(s)	151
BspLI	GGNNCC	1 cut(s)	15
BspPI	GGATC	4 cut(s)	8, 21, 68, 97
BsrDI	GCAATG	1 cut(s)	365
BsrFI	RCCGGY	1 cut(s)	276
BsrI	ACTGG	1 cut(s)	62
BssAI	RCCGGY	1 cut(s)	276
BssECI	CCNNGG	4 cut(s)	35, 244, 310, 431
BssMI	GATC	3 cut(s)	13, 73, 89
BssT1I	CCWWGG	2 cut(s)	35, 244
Bst2UI	CCWGG	2 cut(s)	87, 216
Bst6I	CTCTTC	1 cut(s)	447
BstDEI	CTNAG	1 cut(s)	138
BstDSI	CCRYGG	1 cut(s)	244
BstENI	CCTNNNNNAGG	1 cut(s)	225
BstF5I	GGATG	2 cut(s)	10, 233
BstKTI	GATC	3 cut(s)	16, 76, 92
BstMBI	GATC	3 cut(s)	13, 73, 89
BstNI	CCWGG	2 cut(s)	87, 216
BstSCI	CCNGG	5 cut(s)	85, 214, 309, 310, 430
BstX2I	RGATCY	2 cut(s)	13, 89
BstYI	RGATCY	2 cut(s)	13, 89
BsuRI	GGCC	1 cut(s)	249
BtgI	CCRYGG	1 cut(s)	244
BtsCI	GGATG	2 cut(s)	10, 233
Cfr10I	RCCGGY	1 cut(s)	276
Cfr13I	GGNCC	4 cut(s)	125, 218, 230, 248
Cfr9I	CCCGGG	1 cut(s)	310
CviAII	CATG	5 cut(s)	10, 47, 170, 238, 245
CviJI	RGCY	5 cut(s)	142, 249, 255, 280, 419
CviKI_1	RGCY	5 cut(s)	142, 249, 255, 280, 419
DdeI	CTNAG	1 cut(s)	138
DpnI	GATC	3 cut(s)	15, 75, 91
DpnII	GATC	3 cut(s)	13, 73, 89
Eam1104I	CTCTTC	1 cut(s)	447
EarI	CTCTTC	1 cut(s)	447
Eco130I	CCWWGG	2 cut(s)	35, 244
Eco47I	GGWCC	3 cut(s)	125, 218, 230
Eco57I	CTGAAG	2 cut(s)	78, 246
Eco88I	CYCGRG	1 cut(s)	310
EcoNI	CCTNNNNNAGG	1 cut(s)	225
EcoO109I	RGGNCCY	1 cut(s)	218
EcoRII	CCWGG	2 cut(s)	85, 214
EcoT14I	CCWWGG	2 cut(s)	35, 244
ErhI	CCWWGG	2 cut(s)	35, 244
FaeI	CATG	5 cut(s)	13, 50, 173, 241, 248
FatI	CATG	5 cut(s)	9, 46, 169, 237, 244
FauNDI	CATATG	1 cut(s)	259
FokI	GGATG	2 cut(s)	17, 220
FspBI	CTAG	1 cut(s)	252
HaeIII	GGCC	1 cut(s)	249
HapII	CCGG	3 cut(s)	277, 311, 431
Hin1II	CATG	5 cut(s)	13, 50, 173, 241, 248
HinfI	GANTC	1 cut(s)	270
HpaII	CCGG	3 cut(s)	277, 311, 431
HphI	GGTGA	1 cut(s)	62
Hpy166II	GTNNAC	4 cut(s)	28, 53, 59, 393
Hpy188I	TCNGA	2 cut(s)	18, 97
Hpy188III	TCNNGA	2 cut(s)	123, 340
Hpy8I	GTNNAC	4 cut(s)	28, 53, 59, 393
HpyAV	CCTTC	1 cut(s)	221
HpyCH4IV	ACGT	2 cut(s)	55, 452
HpyCH4V	TGCA	5 cut(s)	68, 157, 169, 317, 370
HpyF3I	CTNAG	1 cut(s)	138
HpySE526I	ACGT	2 cut(s)	55, 452
Hsp92II	CATG	5 cut(s)	13, 50, 173, 241, 248
Kzo9I	GATC	3 cut(s)	13, 73, 89
LweI	GCATC	1 cut(s)	280
MaeI	CTAG	1 cut(s)	252
MaeII	ACGT	2 cut(s)	55, 452
MalI	GATC	3 cut(s)	15, 75, 91
MboI	GATC	3 cut(s)	13, 73, 89
MboII	GAAGA	7 cut(s)	84, 203, 206, 209, 334, 337, 434
MflI	RGATCY	2 cut(s)	13, 89
MluCI	AATT	6 cut(s)	79, 145, 202, 302, 407, 471
MmeI	TCCRAC	1 cut(s)	356
MnlI	CCTC	2 cut(s)	111, 438
MseI	TTAA	4 cut(s)	114, 359, 413, 478
MspI	CCGG	3 cut(s)	277, 311, 431
MspR9I	CCNGG	5 cut(s)	87, 216, 311, 312, 432
MvaI	CCWGG	2 cut(s)	87, 216
NciI	CCSGG	3 cut(s)	311, 312, 432
NcoI	CCATGG	1 cut(s)	244
NdeI	CATATG	1 cut(s)	259
NdeII	GATC	3 cut(s)	13, 73, 89
NlaIII	CATG	5 cut(s)	13, 50, 173, 241, 248
NlaIV	GGNNCC	1 cut(s)	15
PfeI	GAWTC	1 cut(s)	270
PpuMI	RGGWCCY	1 cut(s)	218
Psp1406I	AACGTT	1 cut(s)	55
Psp5II	RGGWCCY	1 cut(s)	218
Psp6I	CCWGG	2 cut(s)	85, 214
PspGI	CCWGG	2 cut(s)	85, 214
PspN4I	GGNNCC	1 cut(s)	15
PspPI	GGNCC	4 cut(s)	125, 218, 230, 248
PspPPI	RGGWCCY	1 cut(s)	218
PsuI	RGATCY	2 cut(s)	13, 89
SaqAI	TTAA	4 cut(s)	114, 359, 413, 478
Sau3AI	GATC	3 cut(s)	13, 73, 89
Sau96I	GGNCC	4 cut(s)	125, 218, 230, 248
ScrFI	CCNGG	5 cut(s)	87, 216, 311, 312, 432
SetI	ASST	5 cut(s)	58, 103, 223, 232, 455
SfaNI	GCATC	1 cut(s)	280
SinI	GGWCC	3 cut(s)	125, 218, 230
SmaI	CCCGGG	1 cut(s)	312
Sse9I	AATT	6 cut(s)	79, 145, 202, 302, 407, 471
SspMI	CTAG	1 cut(s)	252
StyD4I	CCNGG	5 cut(s)	85, 214, 309, 310, 430
StyI	CCWWGG	2 cut(s)	35, 244
TaiI	ACGT	2 cut(s)	58, 455
TasI	AATT	6 cut(s)	79, 145, 202, 302, 407, 471
TfiI	GAWTC	1 cut(s)	270
Tru1I	TTAA	4 cut(s)	114, 359, 413, 478
Tru9I	TTAA	4 cut(s)	114, 359, 413, 478
TspDTI	ATGAA	1 cut(s)	204
TspMI	CCCGGG	1 cut(s)	310
VpaK11BI	GGWCC	3 cut(s)	125, 218, 230
XagI	CCTNNNNNAGG	1 cut(s)	225
XapI	RAATTY	2 cut(s)	145, 471
XmaI	CCCGGG	1 cut(s)	310
XspI	CTAG	1 cut(s)	252

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.