Rh3BG119700

Em-like protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
9882055 .. 9882438
384 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG119700.1

Sequence Viewer

Length: 186 bp
ATGACCTCAGAGCAAGAGAGAAGGAATCCCCAGAAAAGGGCAGAGCTGGACGCCACCGCAAGGCAAGGAGAGACTGTTGTTCCAGGAGGAACTGGTGGCAAAAGTCTTGAGGCTCAGGAGCATCTTGCTGAAGAACGAGATAGACCGTCACAATCCCTCAAACCGATCACCAAACCCCCTTTGTGA

Protein Analysis

61

Amino Acids

6.71

Weight (kDa)

6.57

Isoelectric Point (pI)

65.23

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LEA_5 PF00477 10 - 52 8.7e-17 Small hydrophilic plant seed protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 57
AcuI CTGAAG 1 cut(s) 150
AcyI GRCGYC 1 cut(s) 51
AfiI CCNNNNNNNGG 3 cut(s) 36, 37, 60
AjnI CCWGG 1 cut(s) 82
AluBI AGCT 1 cut(s) 46
AluI AGCT 1 cut(s) 46
Alw26I GTCTC 1 cut(s) 65
AsuHPI GGTGA 1 cut(s) 160
BciT130I CCWGG 1 cut(s) 84
BcoDI GTCTC 1 cut(s) 65
Bme1390I CCNGG 1 cut(s) 84
BmrFI CCNGG 1 cut(s) 84
BmsI GCATC 1 cut(s) 130
Bpu10I CCTNAGC 1 cut(s) 114
BpuEI CTTGAG 1 cut(s) 128
BsaHI GRCGYC 1 cut(s) 51
BsaXI ACNNNNNCTCC 2 cut(s) 60, 90
Bsc4I CCNNNNNNNGG 3 cut(s) 36, 37, 60
Bse1I ACTGG 1 cut(s) 97
BseBI CCWGG 1 cut(s) 84
BseLI CCNNNNNNNGG 3 cut(s) 36, 37, 60
BseMII CTCAG 2 cut(s) 21, 128
BseNI ACTGG 1 cut(s) 97
BslI CCNNNNNNNGG 3 cut(s) 36, 37, 60
BsmAI GTCTC 1 cut(s) 65
Bsp143I GATC 1 cut(s) 165
BspACI CCGC 1 cut(s) 57
BspCNI CTCAG 2 cut(s) 20, 127
BsrI ACTGG 1 cut(s) 97
BssMI GATC 1 cut(s) 165
BssNI GRCGYC 1 cut(s) 51
Bst2UI CCWGG 1 cut(s) 84
Bst4CI ACNGT 2 cut(s) 76, 147
BstACI GRCGYC 1 cut(s) 51
BstDEI CTNAG 2 cut(s) 7, 114
BstKTI GATC 1 cut(s) 168
BstMAI GTCTC 1 cut(s) 65
BstMBI GATC 1 cut(s) 165
BstNI CCWGG 1 cut(s) 84
BstSCI CCNGG 1 cut(s) 82
CseI GACGC 1 cut(s) 59
CviJI RGCY 2 cut(s) 46, 113
CviKI_1 RGCY 2 cut(s) 46, 113
DdeI CTNAG 2 cut(s) 7, 114
DpnI GATC 1 cut(s) 167
DpnII GATC 1 cut(s) 165
Eco57I CTGAAG 1 cut(s) 150
EcoRII CCWGG 1 cut(s) 82
HgaI GACGC 1 cut(s) 59
Hin1I GRCGYC 1 cut(s) 51
HinfI GANTC 1 cut(s) 25
HphI GGTGA 1 cut(s) 160
Hpy188I TCNGA 1 cut(s) 10
Hpy188III TCNNGA 2 cut(s) 107, 116
HpyAV CCTTC 1 cut(s) 15
HpyCH4III ACNGT 2 cut(s) 76, 147
HpyF3I CTNAG 2 cut(s) 7, 114
Hsp92I GRCGYC 1 cut(s) 51
Kzo9I GATC 1 cut(s) 165
LmnI GCTCC 1 cut(s) 118
LpnPI CCDG 6 cut(s) 32, 44, 69, 78, 96, 101
LweI GCATC 1 cut(s) 130
MaeIII GTNAC 1 cut(s) 147
MalI GATC 1 cut(s) 167
MboI GATC 1 cut(s) 165
MboII GAAGA 1 cut(s) 143
MnlI CCTC 4 cut(s) 16, 80, 103, 167
MspR9I CCNGG 1 cut(s) 84
MvaI CCWGG 1 cut(s) 84
NdeII GATC 1 cut(s) 165
NmuCI GTSAC 1 cut(s) 147
PfeI GAWTC 1 cut(s) 25
PfoI TCCNGGA 1 cut(s) 82
Psp6I CCWGG 1 cut(s) 82
PspGI CCWGG 1 cut(s) 82
Sau3AI GATC 1 cut(s) 165
ScrFI CCNGG 1 cut(s) 84
SetI ASST 2 cut(s) 8, 48
SfaNI GCATC 1 cut(s) 130
SmlI CTYRAG 1 cut(s) 107
SmoI CTYRAG 1 cut(s) 107
SsiI CCGC 1 cut(s) 57
StyD4I CCNGG 1 cut(s) 82
TaaI ACNGT 2 cut(s) 76, 147
TfiI GAWTC 1 cut(s) 25
TseFI GTSAC 1 cut(s) 147
Tsp45I GTSAC 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.