Rh3CG351300

Protein of unknown function (DUF707)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
OG0002251
Physical Location & Seq
Forward (+)
42358207 .. 42371382
13176 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG351300.1

Sequence Viewer

Length: 249 bp
ATGTTAGAAGAGAGAGAAGAAATTATATATGTTCCAACAAATCCTTCTGGTGCTAAAACACTACCACCAGGAACTGTTGTTCCACATATTGATCTGTATATGCACAAATTATGGGGTAAACCTAGTGAGTTATTGTCCATGCTCCTTTATTATTTAGGATCTAAAAACCAGCCAAAGTACTTGGTAACATTTACCGTCAGTATTAATCAGAAGAGAAATATTGATGCAGTAGTTAAAATTAACAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF707

Protein Analysis

82

Amino Acids

9.36

Weight (kDa)

8.96

Isoelectric Point (pI)

63.52

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF707 PF05212 13 - 79 2.6e-09 Protein of unknown function (DUF707)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 166
AfaI GTAC 1 cut(s) 179
AjnI CCWGG 1 cut(s) 67
AjuI GAANNNNNNNTTGG 2 cut(s) 28, 60
AloI GAACNNNNNNTCC 4 cut(s) 63, 64, 95, 96
AlwI GGATC 1 cut(s) 166
AlwNI CAGNNNCTG 1 cut(s) 74
AseI ATTAAT 1 cut(s) 204
BciT130I CCWGG 1 cut(s) 69
BfaI CTAG 1 cut(s) 123
BmcAI AGTACT 1 cut(s) 179
Bme1390I CCNGG 1 cut(s) 69
BmrFI CCNGG 1 cut(s) 69
BmsI GCATC 1 cut(s) 214
BseBI CCWGG 1 cut(s) 69
Bsp143I GATC 2 cut(s) 91, 158
BspPI GGATC 1 cut(s) 166
BssMI GATC 2 cut(s) 91, 158
Bst2UI CCWGG 1 cut(s) 69
Bst4CI ACNGT 2 cut(s) 76, 196
Bst6I CTCTTC 2 cut(s) 3, 206
BstKTI GATC 2 cut(s) 94, 161
BstMBI GATC 2 cut(s) 91, 158
BstNI CCWGG 1 cut(s) 69
BstSCI CCNGG 1 cut(s) 67
BstX2I RGATCY 1 cut(s) 158
BstYI RGATCY 1 cut(s) 158
CaiI CAGNNNCTG 1 cut(s) 74
Csp6I GTAC 1 cut(s) 178
CviAII CATG 1 cut(s) 139
CviJI RGCY 1 cut(s) 172
CviKI_1 RGCY 1 cut(s) 172
CviQI GTAC 1 cut(s) 178
DpnI GATC 2 cut(s) 93, 160
DpnII GATC 2 cut(s) 91, 158
Eam1104I CTCTTC 2 cut(s) 3, 206
EarI CTCTTC 2 cut(s) 3, 206
EcoRII CCWGG 1 cut(s) 67
FaeI CATG 1 cut(s) 142
FaiI YATR 8 cut(s) 26, 28, 30, 87, 99, 101, 112, 140
FatI CATG 1 cut(s) 138
FspBI CTAG 1 cut(s) 123
Hin1II CATG 1 cut(s) 142
Hpy166II GTNNAC 1 cut(s) 119
Hpy188I TCNGA 1 cut(s) 210
Hpy8I GTNNAC 1 cut(s) 119
HpyAV CCTTC 1 cut(s) 54
HpyCH4III ACNGT 2 cut(s) 76, 196
HpyCH4V TGCA 2 cut(s) 103, 227
Hsp92II CATG 1 cut(s) 142
Kzo9I GATC 2 cut(s) 91, 158
LmnI GCTCC 1 cut(s) 147
LpnPI CCDG 4 cut(s) 33, 54, 81, 182
LweI GCATC 1 cut(s) 214
MaeI CTAG 1 cut(s) 123
MaeIII GTNAC 1 cut(s) 184
MalI GATC 2 cut(s) 93, 160
MboI GATC 2 cut(s) 91, 158
MboII GAAGA 3 cut(s) 20, 29, 223
MflI RGATCY 1 cut(s) 158
MluCI AATT 4 cut(s) 21, 107, 237, 244
MmeI TCCRAC 1 cut(s) 59
MseI TTAA 4 cut(s) 204, 234, 240, 247
MspR9I CCNGG 1 cut(s) 69
MvaI CCWGG 1 cut(s) 69
NdeII GATC 2 cut(s) 91, 158
NlaIII CATG 1 cut(s) 142
PshBI ATTAAT 1 cut(s) 204
Psp6I CCWGG 1 cut(s) 67
PspGI CCWGG 1 cut(s) 67
PstNI CAGNNNCTG 1 cut(s) 74
PsuI RGATCY 1 cut(s) 158
RsaI GTAC 1 cut(s) 179
RsaNI GTAC 1 cut(s) 178
SaqAI TTAA 4 cut(s) 204, 234, 240, 247
Sau3AI GATC 2 cut(s) 91, 158
ScaI AGTACT 1 cut(s) 179
ScrFI CCNGG 1 cut(s) 69
SetI ASST 1 cut(s) 124
SfaNI GCATC 1 cut(s) 214
SgeI CNNG 7 cut(s) 60, 80, 81, 135, 151, 181, 193
Sse9I AATT 4 cut(s) 21, 107, 237, 244
SspI AATATT 1 cut(s) 220
SspMI CTAG 1 cut(s) 123
StyD4I CCNGG 1 cut(s) 67
TaaI ACNGT 2 cut(s) 76, 196
TasI AATT 4 cut(s) 21, 107, 237, 244
TatI WGTACW 1 cut(s) 177
Tru1I TTAA 4 cut(s) 204, 234, 240, 247
Tru9I TTAA 4 cut(s) 204, 234, 240, 247
VspI ATTAAT 1 cut(s) 204
XspI CTAG 1 cut(s) 123
ZrmI AGTACT 1 cut(s) 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.