Rh5AG311200

Belongs to the CTL (choline transporter-like) family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0002251
Physical Location & Seq
Reverse (-)
44910748 .. 44911794
1047 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG311200.1

Sequence Viewer

Length: 336 bp
ATGCAGTCCAATACTCAGTTTTGTTTCCAGAGAGCCTGGAGTAAAAGTCTTGGAAGTGCTTGTTTTGGTTCTCTGTTTGTGCTAGCAATTGAAGCACTGAGAATTGTTGCTCGGGCTTTAAATCTACTTGAGGGCAAGGATGGGTTTATGTTTTCTTGTGCGCATTGCTTTCTCAATGTCATGCAGTGCATCTTTCGATATGGCGATGGCTGGGCCTTTGTTCAGATATATGTTCCAACAAATCCTTCTGGTGCTGAAACACTACTACCAGGAACTGTTGTTCCACAAATTGATTTGTATATGCACAGATTATGGGATAAACCCAGTGAGGTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Choline_transpo

Protein Analysis

111

Amino Acids

12.47

Weight (kDa)

6.69

Isoelectric Point (pI)

37.13

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Choline_transpo PF04515 5 - 76 9.6e-11 Plasma-membrane choline transporter
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 162
AgsI TTSAA 1 cut(s) 92
AjnI CCWGG 2 cut(s) 35, 268
AjuI GAANNNNNNNTTGG 2 cut(s) 229, 261
AloI GAACNNNNNNTCC 4 cut(s) 264, 265, 296, 297
AlwNI CAGNNNCTG 1 cut(s) 275
Ama87I CYCGRG 1 cut(s) 111
AoxI GGCC 1 cut(s) 213
AspLEI GCGC 1 cut(s) 163
AspS9I GGNCC 1 cut(s) 213
AsuNHI GCTAGC 1 cut(s) 82
AvaI CYCGRG 1 cut(s) 111
BccI CCATC 2 cut(s) 134, 200
BciT130I CCWGG 2 cut(s) 37, 270
BfaI CTAG 1 cut(s) 83
Bme1390I CCNGG 2 cut(s) 37, 270
BmeT110I CYCGRG 1 cut(s) 111
BmgT120I GGNCC 1 cut(s) 213
BmrFI CCNGG 2 cut(s) 37, 270
BmrI ACTGGG 1 cut(s) 318
BmsI GCATC 1 cut(s) 198
BmtI GCTAGC 1 cut(s) 86
BmuI ACTGGG 1 cut(s) 318
BpmI CTGGAG 1 cut(s) 58
BpuEI CTTGAG 1 cut(s) 149
BsaXI ACNNNNNCTCC 2 cut(s) 31, 61
Bse1I ACTGG 1 cut(s) 324
Bse3DI GCAATG 1 cut(s) 163
BseBI CCWGG 2 cut(s) 37, 270
BseGI GGATG 1 cut(s) 145
BseMI GCAATG 1 cut(s) 163
BseMII CTCAG 2 cut(s) 29, 89
BseNI ACTGG 1 cut(s) 324
BseYI CCCAGC 1 cut(s) 210
BshFI GGCC 1 cut(s) 215
BsiHKCI CYCGRG 1 cut(s) 111
BsnI GGCC 1 cut(s) 215
BsoBI CYCGRG 1 cut(s) 111
BspANI GGCC 1 cut(s) 215
BspCNI CTCAG 2 cut(s) 28, 90
BspOI GCTAGC 1 cut(s) 86
BsrDI GCAATG 1 cut(s) 163
BsrI ACTGG 1 cut(s) 324
Bst2UI CCWGG 2 cut(s) 37, 270
Bst4CI ACNGT 1 cut(s) 277
BstC8I GCNNGC 1 cut(s) 84
BstDEI CTNAG 2 cut(s) 15, 98
BstF5I GGATG 1 cut(s) 145
BstHHI GCGC 1 cut(s) 163
BstMWI GCNNNNNNNGC 1 cut(s) 92
BstNI CCWGG 2 cut(s) 37, 270
BstSCI CCNGG 2 cut(s) 35, 268
BsuRI GGCC 1 cut(s) 215
BtgZI GCGATG 1 cut(s) 219
BtsCI GGATG 1 cut(s) 145
BtsI GCAGTG 1 cut(s) 191
BtsIMutI CAGTG 3 cut(s) 95, 191, 331
Cac8I GCNNGC 1 cut(s) 84
CaiI CAGNNNCTG 1 cut(s) 275
CfoI GCGC 1 cut(s) 163
Cfr13I GGNCC 1 cut(s) 213
CviAII CATG 1 cut(s) 181
CviJI RGCY 4 cut(s) 35, 116, 210, 215
CviKI_1 RGCY 4 cut(s) 35, 116, 210, 215
DdeI CTNAG 2 cut(s) 15, 98
DraI TTTAAA 1 cut(s) 120
Eco88I CYCGRG 1 cut(s) 111
EcoRII CCWGG 2 cut(s) 35, 268
FaeI CATG 1 cut(s) 184
FaiI YATR 9 cut(s) 149, 182, 201, 229, 231, 300, 302, 313, 334
FatI CATG 1 cut(s) 180
FokI GGATG 1 cut(s) 152
FspAI RTGCGCAY 1 cut(s) 162
FspBI CTAG 1 cut(s) 83
FspI TGCGCA 1 cut(s) 162
GlaI GCGC 1 cut(s) 162
GsaI CCCAGC 1 cut(s) 214
GsuI CTGGAG 1 cut(s) 58
HaeIII GGCC 1 cut(s) 215
HhaI GCGC 1 cut(s) 163
Hin1II CATG 1 cut(s) 184
Hin6I GCGC 1 cut(s) 161
HinP1I GCGC 1 cut(s) 161
Hpy188I TCNGA 1 cut(s) 225
Hpy188III TCNNGA 1 cut(s) 28
HpyAV CCTTC 1 cut(s) 255
HpyCH4III ACNGT 1 cut(s) 277
HpyCH4V TGCA 4 cut(s) 4, 184, 189, 304
HpyF10VI GCNNNNNNNGC 1 cut(s) 92
HpyF3I CTNAG 2 cut(s) 15, 98
Hsp92II CATG 1 cut(s) 184
HspAI GCGC 1 cut(s) 161
LpnPI CCDG 7 cut(s) 22, 41, 49, 196, 234, 255, 282
LweI GCATC 1 cut(s) 198
MaeI CTAG 1 cut(s) 83
MfeI CAATTG 1 cut(s) 87
MluCI AATT 3 cut(s) 87, 102, 288
MmeI TCCRAC 1 cut(s) 260
MnlI CCTC 2 cut(s) 124, 322
MseI TTAA 1 cut(s) 119
MspR9I CCNGG 2 cut(s) 37, 270
MunI CAATTG 1 cut(s) 87
MvaI CCWGG 2 cut(s) 37, 270
MwoI GCNNNNNNNGC 1 cut(s) 92
NheI GCTAGC 1 cut(s) 82
NlaIII CATG 1 cut(s) 184
NsbI TGCGCA 1 cut(s) 162
Psp6I CCWGG 2 cut(s) 35, 268
PspFI CCCAGC 1 cut(s) 210
PspGI CCWGG 2 cut(s) 35, 268
PspPI GGNCC 1 cut(s) 213
PstNI CAGNNNCTG 1 cut(s) 275
SaqAI TTAA 1 cut(s) 119
Sau96I GGNCC 1 cut(s) 213
ScrFI CCNGG 2 cut(s) 37, 270
SetI ASST 1 cut(s) 333
SfaNI GCATC 1 cut(s) 198
SmlI CTYRAG 1 cut(s) 128
SmoI CTYRAG 1 cut(s) 128
Sse9I AATT 3 cut(s) 87, 102, 288
SspMI CTAG 1 cut(s) 83
StyD4I CCNGG 2 cut(s) 35, 268
TaaI ACNGT 1 cut(s) 277
TaqI TCGA 1 cut(s) 196
TasI AATT 3 cut(s) 87, 102, 288
Tru1I TTAA 1 cut(s) 119
Tru9I TTAA 1 cut(s) 119
TscAI CASTG 3 cut(s) 102, 191, 331
TspRI CASTG 3 cut(s) 102, 191, 331
XspI CTAG 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.