Rh5AG264900

disease resistance protein At4g27220

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0002553
Physical Location & Seq
Reverse (-)
34880767 .. 34886458
5692 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG264900.1

Sequence Viewer

Length: 396 bp
ATGCACAAGCCTTTAATGGATATTGTCAATTCAAGGAATCATTCTCTGTCCAAGTTCAAATTCTGTGTCGACGAATCTTGTAAGAAGCAGTTACCTGATAACAGCCAAGCCTTTACCAATAGTAACATCCTTGTGAAAGGAAATCCATTCTCACTGCCTGAAGACACCTCTGAGCTGCATGTAATGAGAAATTTGGATCTGCAATGCTTGCCAAGTTGTTGCTTCGATAGCTTGAAGGTCATCAACATTTCTGGCTGTGAAAGTTTGGGCAATTTATTCAAAATTAACATGGTTTACAGCCTTCCAAACCTGGAAACAATTTCAGTTGAAAAATGTCAGAAGATGGAGGCACTGATAGAGTGGTCAGAATATCCTGATGATTCACTTCATTCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_8 NB-ARC

Protein Analysis

131

Amino Acids

14.86

Weight (kDa)

5.27

Isoelectric Point (pI)

51.55

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRR_RPS2 PF23247 71 - 123 4.8e-08 Plant disease resistance protein RPS2-like, leucine-rich repeats
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 69
AclWI GGATC 1 cut(s) 204
AcsI RAATTY 2 cut(s) 59, 190
AcuI CTGAAG 1 cut(s) 180
AgsI TTSAA 5 cut(s) 33, 58, 235, 280, 329
AjnI CCWGG 1 cut(s) 309
AjuI GAANNNNNNNTTGG 2 cut(s) 44, 76
AluBI AGCT 2 cut(s) 175, 231
AluI AGCT 2 cut(s) 175, 231
AlwI GGATC 1 cut(s) 204
ApeKI GCWGC 1 cut(s) 175
ApoI RAATTY 2 cut(s) 59, 190
ArsI GACNNNNNNTTYG 2 cut(s) 51, 83
BbsI GAAGAC 1 cut(s) 168
BbvI GCAGC 1 cut(s) 162
BccI CCATC 1 cut(s) 337
BciT130I CCWGG 1 cut(s) 311
BisI GCNGC 1 cut(s) 176
BlsI GCNGC 1 cut(s) 177
Bme1390I CCNGG 1 cut(s) 311
BmrFI CCNGG 1 cut(s) 311
BpiI GAAGAC 1 cut(s) 168
Bse3DI GCAATG 1 cut(s) 209
BseBI CCWGG 1 cut(s) 311
BseGI GGATG 1 cut(s) 126
BseMI GCAATG 1 cut(s) 209
BseMII CTCAG 1 cut(s) 162
BseXI GCAGC 1 cut(s) 162
Bsp143I GATC 1 cut(s) 196
BspCNI CTCAG 1 cut(s) 163
BspPI GGATC 1 cut(s) 204
BsrDI GCAATG 1 cut(s) 209
BssMI GATC 1 cut(s) 196
Bst2UI CCWGG 1 cut(s) 311
BstAPI GCANNNNNTGC 1 cut(s) 208
BstC8I GCNNGC 1 cut(s) 209
BstDEI CTNAG 1 cut(s) 171
BstF5I GGATG 1 cut(s) 126
BstKTI GATC 1 cut(s) 199
BstMBI GATC 1 cut(s) 196
BstMWI GCNNNNNNNGC 2 cut(s) 208, 228
BstNI CCWGG 1 cut(s) 311
BstNSI RCATGY 1 cut(s) 182
BstSCI CCNGG 1 cut(s) 309
BstV1I GCAGC 1 cut(s) 162
BstV2I GAAGAC 1 cut(s) 168
BstX2I RGATCY 1 cut(s) 196
BstYI RGATCY 1 cut(s) 196
BtsCI GGATG 1 cut(s) 126
BtsI GCAGTG 1 cut(s) 152
BtsIMutI CAGTG 2 cut(s) 152, 350
Cac8I GCNNGC 1 cut(s) 209
CviAII CATG 2 cut(s) 179, 289
CviJI RGCY 7 cut(s) 10, 105, 110, 175, 231, 255, 300
CviKI_1 RGCY 7 cut(s) 10, 105, 110, 175, 231, 255, 300
DdeI CTNAG 1 cut(s) 171
DpnI GATC 1 cut(s) 198
DpnII GATC 1 cut(s) 196
Eco57I CTGAAG 1 cut(s) 180
EcoRII CCWGG 1 cut(s) 309
FaeI CATG 2 cut(s) 182, 292
FaiI YATR 3 cut(s) 180, 290, 394
FatI CATG 2 cut(s) 178, 288
FblI GTMKAC 1 cut(s) 69
Fnu4HI GCNGC 1 cut(s) 176
FokI GGATG 1 cut(s) 113
Fsp4HI GCNGC 1 cut(s) 176
GluI GCNGC 1 cut(s) 176
Hin1II CATG 2 cut(s) 182, 292
HincII GTYRAC 1 cut(s) 70
HindII GTYRAC 1 cut(s) 70
HinfI GANTC 3 cut(s) 37, 74, 380
Hpy166II GTNNAC 2 cut(s) 70, 295
Hpy188I TCNGA 3 cut(s) 172, 339, 367
Hpy188III TCNNGA 1 cut(s) 374
Hpy8I GTNNAC 2 cut(s) 70, 295
Hpy99I CGWCG 1 cut(s) 74
HpyAV CCTTC 2 cut(s) 229, 311
HpyCH4V TGCA 3 cut(s) 4, 178, 202
HpyF10VI GCNNNNNNNGC 2 cut(s) 208, 228
HpyF3I CTNAG 1 cut(s) 171
Hsp92II CATG 2 cut(s) 182, 292
Kzo9I GATC 1 cut(s) 196
LpnPI CCDG 6 cut(s) 108, 171, 237, 296, 323, 387
Lsp1109I GCAGC 1 cut(s) 162
MaeIII GTNAC 2 cut(s) 90, 122
MalI GATC 1 cut(s) 198
MboI GATC 1 cut(s) 196
MboII GAAGA 2 cut(s) 173, 352
MflI RGATCY 1 cut(s) 196
MluCI AATT 6 cut(s) 28, 59, 190, 271, 282, 318
MnlI CCTC 2 cut(s) 178, 340
MseI TTAA 2 cut(s) 14, 285
MslI CAYNNNNRTG 1 cut(s) 131
MspR9I CCNGG 1 cut(s) 311
MvaI CCWGG 1 cut(s) 311
MwoI GCNNNNNNNGC 2 cut(s) 208, 228
NdeII GATC 1 cut(s) 196
NlaIII CATG 2 cut(s) 182, 292
NspI RCATGY 1 cut(s) 182
PfeI GAWTC 3 cut(s) 37, 74, 380
PkrI GCNGC 1 cut(s) 177
Psp6I CCWGG 1 cut(s) 309
PspGI CCWGG 1 cut(s) 309
PsuI RGATCY 1 cut(s) 196
RseI CAYNNNNRTG 1 cut(s) 131
SalI GTCGAC 1 cut(s) 68
SaqAI TTAA 2 cut(s) 14, 285
SatI GCNGC 1 cut(s) 176
Sau3AI GATC 1 cut(s) 196
ScrFI CCNGG 1 cut(s) 311
SetI ASST 6 cut(s) 97, 170, 177, 233, 240, 312
SmiMI CAYNNNNRTG 1 cut(s) 131
Sse9I AATT 6 cut(s) 28, 59, 190, 271, 282, 318
StyD4I CCNGG 1 cut(s) 309
TaqI TCGA 2 cut(s) 69, 225
TasI AATT 6 cut(s) 28, 59, 190, 271, 282, 318
TfiI GAWTC 3 cut(s) 37, 74, 380
Tru1I TTAA 2 cut(s) 14, 285
Tru9I TTAA 2 cut(s) 14, 285
TscAI CASTG 2 cut(s) 159, 357
TseI GCWGC 1 cut(s) 175
TspDTI ATGAA 2 cut(s) 377, 381
TspRI CASTG 2 cut(s) 159, 357
XapI RAATTY 2 cut(s) 59, 190
XceI RCATGY 1 cut(s) 182
XmiI GTMKAC 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.