Rh5BG245800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
29882074 .. 29882400
327 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG245800.1

Sequence Viewer

Length: 327 bp
ATGTCTCAGCCTTGCTATGAGCAATATCAACCATCCTTTCAGCAGCCGCAGCCTCTTTACCAACAACTTCATCCTTCCTATAAAAGCAGCCGCAGCCTTGCTATGAGCACTATCAACCATTCTTTCAGCAGCCGCAGCCTTTGTACCAACAACTTCATCCTTCCTACATGCAGCCGCAGCCTTGCTACGAGCACTATCAACCATTCTTCAGCAGCCACAGCCTCCGTACCAACAACTTCATCCTTCCTACATGCAGCCACAGCCTCAGTACCAACAGCAGAATCCTTCCTACATGCAGCTGCCGCCACCAATTCATCAAGTGTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

108

Amino Acids

11.56

Weight (kDa)

8.59

Isoelectric Point (pI)

71.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 5 cut(s) 47, 91, 133, 175, 303
AcuI CTGAAG 1 cut(s) 192
AfaI GTAC 3 cut(s) 145, 228, 270
AluBI AGCT 1 cut(s) 299
AluI AGCT 1 cut(s) 299
Alw21I GWGCWC 2 cut(s) 110, 194
Alw26I GTCTC 1 cut(s) 9
Bbv12I GWGCWC 2 cut(s) 110, 194
BccI CCATC 1 cut(s) 40
BcoDI GTCTC 1 cut(s) 9
BseGI GGATG 4 cut(s) 32, 70, 156, 239
BseMII CTCAG 2 cut(s) 20, 279
BsiHKAI GWGCWC 2 cut(s) 110, 194
BsmAI GTCTC 1 cut(s) 9
Bsp1286I GDGCHC 2 cut(s) 110, 194
BspACI CCGC 5 cut(s) 47, 91, 133, 175, 303
BspCNI CTCAG 2 cut(s) 19, 278
BstDEI CTNAG 2 cut(s) 6, 265
BstF5I GGATG 4 cut(s) 32, 70, 156, 239
BstMAI GTCTC 1 cut(s) 9
BstMWI GCNNNNNNNGC 7 cut(s) 49, 93, 135, 177, 218, 260, 302
BstNSI RCATGY 3 cut(s) 171, 254, 296
BtsCI GGATG 4 cut(s) 32, 70, 156, 239
Csp6I GTAC 3 cut(s) 144, 227, 269
CviAII CATG 3 cut(s) 168, 251, 293
CviQI GTAC 3 cut(s) 144, 227, 269
DdeI CTNAG 2 cut(s) 6, 265
Eco57I CTGAAG 1 cut(s) 192
FaeI CATG 3 cut(s) 171, 254, 296
FaiI YATR 6 cut(s) 18, 81, 104, 169, 252, 294
FatI CATG 3 cut(s) 167, 250, 292
FokI GGATG 4 cut(s) 19, 57, 143, 226
Hin1II CATG 3 cut(s) 171, 254, 296
HinfI GANTC 1 cut(s) 281
Hpy188I TCNGA 1 cut(s) 326
HpyAV CCTTC 4 cut(s) 84, 170, 253, 295
HpyCH4V TGCA 3 cut(s) 171, 254, 296
HpyF10VI GCNNNNNNNGC 7 cut(s) 49, 93, 135, 177, 218, 260, 302
HpyF3I CTNAG 2 cut(s) 6, 265
Hsp92II CATG 3 cut(s) 171, 254, 296
MboII GAAGA 1 cut(s) 198
MhlI GDGCHC 2 cut(s) 110, 194
MluCI AATT 1 cut(s) 310
MnlI CCTC 3 cut(s) 63, 232, 274
MspA1I CMGCKG 1 cut(s) 299
MwoI GCNNNNNNNGC 7 cut(s) 49, 93, 135, 177, 218, 260, 302
NlaIII CATG 3 cut(s) 171, 254, 296
NspI RCATGY 3 cut(s) 171, 254, 296
PfeI GAWTC 1 cut(s) 281
PvuII CAGCTG 1 cut(s) 299
RsaI GTAC 3 cut(s) 145, 228, 270
RsaNI GTAC 3 cut(s) 144, 227, 269
SduI GDGCHC 2 cut(s) 110, 194
SetI ASST 1 cut(s) 301
SgeI CNNG 7 cut(s) 24, 110, 180, 194, 201, 263, 305
Sse9I AATT 1 cut(s) 310
SsiI CCGC 5 cut(s) 47, 91, 133, 175, 303
TasI AATT 1 cut(s) 310
TauI GCSGC 5 cut(s) 49, 93, 135, 177, 305
TfiI GAWTC 1 cut(s) 281
TspDTI ATGAA 4 cut(s) 59, 145, 228, 303
TspGWI ACGGA 1 cut(s) 214
XceI RCATGY 3 cut(s) 171, 254, 296
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.