AT3G03840

Disease resistance protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
OG0002411
Physical Location & Seq
Forward (+)
981072 .. 981801
730 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G03840.1

Sequence Viewer

Length: 288 bp
ATGGCTTTGGTGAGAAGTCTCTTTGTTTCAAACAAGATACTTGGAGGCTCATTAGCAGGAATGAGAAAATCAACTTCAGCACCAAAAGGGTTTCTTGCAGTGTACGTAGGGGAGAGCCAGAAGAAGCAGAGATACTTAGTGCTAGTCTCATACTTGAGCCAGCCATTGTTTCAAGATCTTCTCAGTAAATCCGAGGAAGAGTTCGGATTTGATCATCCGATGGGGGGCTTGACGATCCCTTGTCCTGAAGATACCTTCCTCACTGTAACTTCTCGGATCCAAGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_1 LRR_3 NB-ARC TIR

Protein Analysis

95

Amino Acids

10.41

Weight (kDa)

8.85

Isoelectric Point (pI)

46.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 22 - 92 7.9e-21 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 229, 271, 284
AcuI CTGAAG 2 cut(s) 60, 267
AfaI GTAC 1 cut(s) 104
AfiI CCNNNNNNNGG 1 cut(s) 224
AgsI TTSAA 2 cut(s) 30, 173
Alw26I GTCTC 2 cut(s) 23, 151
AlwI GGATC 3 cut(s) 229, 271, 284
AsuHPI GGTGA 1 cut(s) 22
BamHI GGATCC 1 cut(s) 276
BarI GAAGNNNNNNTAC 2 cut(s) 116, 148
BccI CCATC 1 cut(s) 214
BclI TGATCA 1 cut(s) 211
BcoDI GTCTC 2 cut(s) 23, 151
BfaI CTAG 1 cut(s) 143
BglII AGATCT 1 cut(s) 175
BmiI GGNNCC 1 cut(s) 278
BpuEI CTTGAG 1 cut(s) 175
BsaAI YACGTR 1 cut(s) 106
BsaJI CCNNGG 2 cut(s) 192, 280
Bsc4I CCNNNNNNNGG 1 cut(s) 224
BseDI CCNNGG 2 cut(s) 192, 280
BseGI GGATG 1 cut(s) 214
BseLI CCNNNNNNNGG 1 cut(s) 224
BseMII CTCAG 1 cut(s) 196
BslI CCNNNNNNNGG 1 cut(s) 224
BsmAI GTCTC 2 cut(s) 23, 151
Bsp143I GATC 4 cut(s) 175, 211, 234, 276
BspCNI CTCAG 1 cut(s) 195
BspLI GGNNCC 1 cut(s) 278
BspPI GGATC 3 cut(s) 229, 271, 284
BssECI CCNNGG 2 cut(s) 192, 280
BssMI GATC 4 cut(s) 175, 211, 234, 276
BssT1I CCWWGG 1 cut(s) 280
Bst4CI ACNGT 1 cut(s) 265
Bst6I CTCTTC 1 cut(s) 192
BstBAI YACGTR 1 cut(s) 106
BstC8I GCNNGC 1 cut(s) 161
BstDEI CTNAG 2 cut(s) 136, 182
BstF5I GGATG 1 cut(s) 214
BstKTI GATC 4 cut(s) 178, 214, 237, 279
BstMAI GTCTC 2 cut(s) 23, 151
BstMBI GATC 4 cut(s) 175, 211, 234, 276
BstSNI TACGTA 1 cut(s) 106
BstX2I RGATCY 2 cut(s) 175, 276
BstYI RGATCY 2 cut(s) 175, 276
BtsCI GGATG 1 cut(s) 214
BtsI GCAGTG 1 cut(s) 105
BtsIMutI CAGTG 2 cut(s) 105, 261
Cac8I GCNNGC 1 cut(s) 161
Csp6I GTAC 1 cut(s) 103
CviJI RGCY 6 cut(s) 5, 48, 117, 159, 163, 228
CviKI_1 RGCY 6 cut(s) 5, 48, 117, 159, 163, 228
CviQI GTAC 1 cut(s) 103
DdeI CTNAG 2 cut(s) 136, 182
DpnI GATC 4 cut(s) 177, 213, 236, 278
DpnII GATC 4 cut(s) 175, 211, 234, 276
Eam1104I CTCTTC 1 cut(s) 192
EarI CTCTTC 1 cut(s) 192
Eco105I TACGTA 1 cut(s) 106
Eco130I CCWWGG 1 cut(s) 280
Eco57I CTGAAG 2 cut(s) 60, 267
EcoT14I CCWWGG 1 cut(s) 280
ErhI CCWWGG 1 cut(s) 280
FaiI YATR 1 cut(s) 151
FalI AAGNNNNNCTT 2 cut(s) 78, 110
FbaI TGATCA 1 cut(s) 211
FokI GGATG 1 cut(s) 201
FspBI CTAG 1 cut(s) 143
HphI GGTGA 1 cut(s) 22
Hpy166II GTNNAC 1 cut(s) 103
Hpy188I TCNGA 4 cut(s) 193, 206, 219, 276
Hpy188III TCNNGA 2 cut(s) 173, 245
Hpy8I GTNNAC 1 cut(s) 103
HpyAV CCTTC 1 cut(s) 265
HpyCH4III ACNGT 1 cut(s) 265
HpyCH4IV ACGT 1 cut(s) 105
HpyCH4V TGCA 1 cut(s) 98
HpyF3I CTNAG 2 cut(s) 136, 182
HpySE526I ACGT 1 cut(s) 105
Ksp22I TGATCA 1 cut(s) 211
Kzo9I GATC 4 cut(s) 175, 211, 234, 276
LpnPI CCDG 4 cut(s) 42, 131, 173, 258
MaeI CTAG 1 cut(s) 143
MaeII ACGT 1 cut(s) 105
MaeIII GTNAC 1 cut(s) 265
MalI GATC 4 cut(s) 177, 213, 236, 278
MboI GATC 4 cut(s) 175, 211, 234, 276
MboII GAAGA 4 cut(s) 133, 170, 209, 260
MflI RGATCY 2 cut(s) 175, 276
MnlI CCTC 3 cut(s) 38, 187, 269
NdeII GATC 4 cut(s) 175, 211, 234, 276
NlaIV GGNNCC 1 cut(s) 278
Ppu21I YACGTR 1 cut(s) 106
PspN4I GGNNCC 1 cut(s) 278
PsuI RGATCY 2 cut(s) 175, 276
RsaI GTAC 1 cut(s) 104
RsaNI GTAC 1 cut(s) 103
Sau3AI GATC 4 cut(s) 175, 211, 234, 276
SetI ASST 2 cut(s) 108, 257
SmlI CTYRAG 1 cut(s) 154
SmoI CTYRAG 1 cut(s) 154
SnaBI TACGTA 1 cut(s) 106
SspMI CTAG 1 cut(s) 143
StyI CCWWGG 1 cut(s) 280
TaaI ACNGT 1 cut(s) 265
TaiI ACGT 1 cut(s) 108
TscAI CASTG 2 cut(s) 105, 268
TspRI CASTG 2 cut(s) 105, 268
XspI CTAG 1 cut(s) 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.