Rw5G034950

Auxin responsive protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
OG0002411
Physical Location & Seq
Forward (+)
60336213 .. 60336513
301 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G034950.1

Sequence Viewer

Length: 267 bp
ATGGCTATCCGATTGCCTGCCATTATGCATGCTAAGCAGATTCTCCGGCGAGGAAGTTTGTTGGCTTTTAAAGCAGATTTAATACATGCTGATAATGTAGTGAAAAGATACATAGTTCCAGTTTCTTTCTTGAGTCAGCCTTCATTTCAAGAGTTGCTGAGTAAGGCAGAGGAAGAATATGGATTCGACCATCCAATGGGTGGACTCACAATTCCTTGCCGAGAAGAAACCTTCATTGATCTCACTCCTTGCTTGAAGGGGCTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04075 map04075
Pfam Domains
Protein Families
Auxin_inducible

Protein Analysis

88

Amino Acids

9.9

Weight (kDa)

6.82

Isoelectric Point (pI)

58.62

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 35 - 82 2e-14 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 196, 200
AfiI CCNNNNNNNGG 2 cut(s) 196, 200
AgsI TTSAA 2 cut(s) 149, 256
BccI CCATC 1 cut(s) 198
BlpI GCTNAGC 1 cut(s) 33
Bpu1102I GCTNAGC 1 cut(s) 33
BpuEI CTTGAG 1 cut(s) 151
Bsc4I CCNNNNNNNGG 2 cut(s) 196, 200
Bse1I ACTGG 1 cut(s) 119
BseGI GGATG 1 cut(s) 190
BseLI CCNNNNNNNGG 2 cut(s) 196, 200
BseMII CTCAG 1 cut(s) 149
BseNI ACTGG 1 cut(s) 119
BsiSI CCGG 1 cut(s) 46
BslI CCNNNNNNNGG 2 cut(s) 196, 200
Bsp143I GATC 1 cut(s) 238
Bsp1720I GCTNAGC 1 cut(s) 33
BspCNI CTCAG 1 cut(s) 150
BsrI ACTGG 1 cut(s) 119
BssMI GATC 1 cut(s) 238
BstC8I GCNNGC 2 cut(s) 18, 30
BstDEI CTNAG 2 cut(s) 33, 158
BstF5I GGATG 1 cut(s) 190
BstKTI GATC 1 cut(s) 241
BstMBI GATC 1 cut(s) 238
BstMWI GCNNNNNNNGC 2 cut(s) 34, 71
BstNSI RCATGY 2 cut(s) 32, 89
BtsCI GGATG 1 cut(s) 190
Cac8I GCNNGC 2 cut(s) 18, 30
CviAII CATG 2 cut(s) 29, 86
CviJI RGCY 4 cut(s) 5, 65, 139, 262
CviKI_1 RGCY 4 cut(s) 5, 65, 139, 262
DdeI CTNAG 2 cut(s) 33, 158
DpnI GATC 1 cut(s) 240
DpnII GATC 1 cut(s) 238
DraI TTTAAA 1 cut(s) 70
EcoT22I ATGCAT 1 cut(s) 30
FaeI CATG 2 cut(s) 32, 89
FaiI YATR 5 cut(s) 26, 30, 87, 113, 180
FatI CATG 2 cut(s) 28, 85
FokI GGATG 1 cut(s) 177
HapII CCGG 1 cut(s) 46
Hin1II CATG 2 cut(s) 32, 89
HinfI GANTC 4 cut(s) 40, 133, 183, 204
HpaII CCGG 1 cut(s) 46
Hpy166II GTNNAC 1 cut(s) 203
Hpy188I TCNGA 1 cut(s) 11
Hpy188III TCNNGA 2 cut(s) 130, 149
Hpy8I GTNNAC 1 cut(s) 203
HpyAV CCTTC 3 cut(s) 150, 241, 250
HpyCH4V TGCA 1 cut(s) 28
HpyF10VI GCNNNNNNNGC 2 cut(s) 34, 71
HpyF3I CTNAG 2 cut(s) 33, 158
Hsp92II CATG 2 cut(s) 32, 89
Kzo9I GATC 1 cut(s) 238
LpnPI CCDG 3 cut(s) 30, 59, 132
MalI GATC 1 cut(s) 240
MboI GATC 1 cut(s) 238
MboII GAAGA 2 cut(s) 185, 236
MluCI AATT 1 cut(s) 210
MlyI GAGTC 2 cut(s) 142, 198
MnlI CCTC 2 cut(s) 44, 163
Mph1103I ATGCAT 1 cut(s) 30
MseI TTAA 2 cut(s) 69, 80
MspI CCGG 1 cut(s) 46
MwoI GCNNNNNNNGC 2 cut(s) 34, 71
NdeII GATC 1 cut(s) 238
NlaIII CATG 2 cut(s) 32, 89
NmeAIII GCCGAG 1 cut(s) 245
NsiI ATGCAT 1 cut(s) 30
NspI RCATGY 2 cut(s) 32, 89
PaeI GCATGC 1 cut(s) 32
PfeI GAWTC 2 cut(s) 40, 183
PflMI CCANNNNNTGG 2 cut(s) 196, 200
PleI GAGTC 2 cut(s) 141, 198
PpsI GAGTC 2 cut(s) 141, 198
SaqAI TTAA 2 cut(s) 69, 80
Sau3AI GATC 1 cut(s) 238
SchI GAGTC 2 cut(s) 142, 198
SetI ASST 1 cut(s) 233
SmlI CTYRAG 1 cut(s) 130
SmoI CTYRAG 1 cut(s) 130
SphI GCATGC 1 cut(s) 32
Sse9I AATT 1 cut(s) 210
TaqI TCGA 1 cut(s) 186
TasI AATT 1 cut(s) 210
TfiI GAWTC 2 cut(s) 40, 183
Tru1I TTAA 2 cut(s) 69, 80
Tru9I TTAA 2 cut(s) 69, 80
TspDTI ATGAA 2 cut(s) 132, 223
Van91I CCANNNNNTGG 2 cut(s) 196, 200
XceI RCATGY 2 cut(s) 32, 89
XcmI CCANNNNNNNNNTGG 1 cut(s) 197
Zsp2I ATGCAT 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.