FvH4_2g11140

Belongs to the eukaryotic ribosomal protein eL38 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb2
OG0001881
Physical Location & Seq
Reverse (-)
9718219 .. 9720404
2186 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_2g11140.t1

Sequence Viewer

Length: 210 bp
ATGCCGAAGCAAATCCATGAGATCAAGGATTTCCTCCTGACTGCAAGAAGGAAGGATGCACGCTCTGTGAAAATCAAGAAGACGAAAGACGCAGTCAAGTTCAAGGTTCGATGCTCCAAGTACCTTTACACACTTTGTGTGTTTGATACCGAGAAGGCTGATAAGTTGAAGCAATCCCTTCCTCCAGGTTTGACTGTTCAGGATCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L38e

Protein Analysis

70

Amino Acids

8.02

Weight (kDa)

9.85

Isoelectric Point (pI)

43.2

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L38e PF01781 2 - 68 1.9e-35 Ribosomal L38e protein family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AdeI CACNNNGTG 1 cut(s) 137
AfaI GTAC 1 cut(s) 122
AgsI TTSAA 2 cut(s) 103, 169
AjnI CCWGG 1 cut(s) 184
BbsI GAAGAC 1 cut(s) 86
BciT130I CCWGG 1 cut(s) 186
Bme1390I CCNGG 1 cut(s) 186
BmrFI CCNGG 1 cut(s) 186
BmsI GCATC 2 cut(s) 46, 101
BpiI GAAGAC 1 cut(s) 86
BpmI CTGGAG 1 cut(s) 168
BseBI CCWGG 1 cut(s) 186
BseGI GGATG 1 cut(s) 61
Bsp143I GATC 2 cut(s) 21, 202
BssMI GATC 2 cut(s) 21, 202
Bst2UI CCWGG 1 cut(s) 186
Bst4CI ACNGT 1 cut(s) 196
BstC8I GCNNGC 1 cut(s) 61
BstF5I GGATG 1 cut(s) 61
BstKTI GATC 2 cut(s) 24, 205
BstMBI GATC 2 cut(s) 21, 202
BstNI CCWGG 1 cut(s) 186
BstSCI CCNGG 1 cut(s) 184
BstV2I GAAGAC 1 cut(s) 86
BstX2I RGATCY 1 cut(s) 202
BstYI RGATCY 1 cut(s) 202
BtsCI GGATG 1 cut(s) 61
Cac8I GCNNGC 1 cut(s) 61
CseI GACGC 1 cut(s) 98
Csp6I GTAC 1 cut(s) 121
CviAII CATG 1 cut(s) 17
CviJI RGCY 1 cut(s) 158
CviKI_1 RGCY 1 cut(s) 158
CviQI GTAC 1 cut(s) 121
DpnI GATC 2 cut(s) 23, 204
DpnII GATC 2 cut(s) 21, 202
DraIII CACNNNGTG 1 cut(s) 137
EcoRII CCWGG 1 cut(s) 184
FaeI CATG 1 cut(s) 20
FaiI YATR 1 cut(s) 18
FatI CATG 1 cut(s) 16
FokI GGATG 1 cut(s) 68
GsuI CTGGAG 1 cut(s) 168
HgaI GACGC 1 cut(s) 98
Hin1II CATG 1 cut(s) 20
Hpy188III TCNNGA 3 cut(s) 37, 76, 200
HpyAV CCTTC 4 cut(s) 42, 46, 148, 188
HpyCH4III ACNGT 1 cut(s) 196
HpyCH4V TGCA 2 cut(s) 44, 59
Hsp92II CATG 1 cut(s) 20
Kzo9I GATC 2 cut(s) 21, 202
LmnI GCTCC 1 cut(s) 119
LpnPI CCDG 4 cut(s) 50, 171, 185, 198
LweI GCATC 2 cut(s) 46, 101
MalI GATC 2 cut(s) 23, 204
MboI GATC 2 cut(s) 21, 202
MboII GAAGA 1 cut(s) 91
MflI RGATCY 1 cut(s) 202
MnlI CCTC 2 cut(s) 44, 192
MspR9I CCNGG 1 cut(s) 186
MvaI CCWGG 1 cut(s) 186
NdeII GATC 2 cut(s) 21, 202
NlaIII CATG 1 cut(s) 20
PflFI GACNNNGTC 1 cut(s) 92
Psp6I CCWGG 1 cut(s) 184
PspGI CCWGG 1 cut(s) 184
PsuI RGATCY 1 cut(s) 202
PsyI GACNNNGTC 1 cut(s) 92
RsaI GTAC 1 cut(s) 122
RsaNI GTAC 1 cut(s) 121
Sau3AI GATC 2 cut(s) 21, 202
ScrFI CCNGG 1 cut(s) 186
SetI ASST 3 cut(s) 108, 126, 190
SfaNI GCATC 2 cut(s) 46, 101
StyD4I CCNGG 1 cut(s) 184
TaaI ACNGT 1 cut(s) 196
TaqI TCGA 1 cut(s) 109
Tth111I GACNNNGTC 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.