MD15G1353900.v1.1

Belongs to the eukaryotic ribosomal protein eL38 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
OG0001881
Physical Location & Seq
Reverse (-)
42440998 .. 42441171
174 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1353900.v1.1.491

Sequence Viewer

Length: 174 bp
ATGCCGAAGCAGATCCATGAGATCAAGGATTTCCTTCTAACTGCAAGAAGGAAGGATGCCCGCAATGTCAAAATCAAGAGGACCAAGGATGCTGTCAAGTTCAAGGTTCGGTGCTCCAAGTACCTTTACACACTTTGTGTGTTTGATTCCGAGAAGGCCGACAAGTTGAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L38e

Protein Analysis

58

Amino Acids

6.82

Weight (kDa)

10.02

Isoelectric Point (pI)

34.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L38e PF01781 2 - 57 1.8e-27 Ribosomal L38e protein family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 61
AclWI GGATC 1 cut(s) 7
AdeI CACNNNGTG 1 cut(s) 137
AfaI GTAC 1 cut(s) 122
AgsI TTSAA 2 cut(s) 103, 169
Alw21I GWGCWC 1 cut(s) 116
AlwI GGATC 1 cut(s) 7
AoxI GGCC 1 cut(s) 156
AspS9I GGNCC 1 cut(s) 81
AvaII GGWCC 1 cut(s) 81
Bbv12I GWGCWC 1 cut(s) 116
Bme18I GGWCC 1 cut(s) 81
BmgT120I GGNCC 1 cut(s) 81
BmsI GCATC 2 cut(s) 46, 79
BsaJI CCNNGG 1 cut(s) 84
Bse3DI GCAATG 1 cut(s) 70
BseDI CCNNGG 1 cut(s) 84
BseGI GGATG 2 cut(s) 61, 94
BseMI GCAATG 1 cut(s) 70
BshFI GGCC 1 cut(s) 158
BsiHKAI GWGCWC 1 cut(s) 116
BsnI GGCC 1 cut(s) 158
Bsp1286I GDGCHC 1 cut(s) 116
Bsp143I GATC 2 cut(s) 12, 21
BspACI CCGC 1 cut(s) 61
BspANI GGCC 1 cut(s) 158
BspPI GGATC 1 cut(s) 7
BsrDI GCAATG 1 cut(s) 70
BssECI CCNNGG 1 cut(s) 84
BssMI GATC 2 cut(s) 12, 21
BssT1I CCWWGG 1 cut(s) 84
BstC8I GCNNGC 1 cut(s) 61
BstF5I GGATG 2 cut(s) 61, 94
BstKTI GATC 2 cut(s) 15, 24
BstMBI GATC 2 cut(s) 12, 21
BstX2I RGATCY 1 cut(s) 12
BstYI RGATCY 1 cut(s) 12
BsuRI GGCC 1 cut(s) 158
BtsCI GGATG 2 cut(s) 61, 94
Cac8I GCNNGC 1 cut(s) 61
Cfr13I GGNCC 1 cut(s) 81
Csp6I GTAC 1 cut(s) 121
CviAII CATG 1 cut(s) 17
CviJI RGCY 1 cut(s) 158
CviKI_1 RGCY 1 cut(s) 158
CviQI GTAC 1 cut(s) 121
DpnI GATC 2 cut(s) 14, 23
DpnII GATC 2 cut(s) 12, 21
DraIII CACNNNGTG 1 cut(s) 137
Eco130I CCWWGG 1 cut(s) 84
Eco47I GGWCC 1 cut(s) 81
EcoT14I CCWWGG 1 cut(s) 84
ErhI CCWWGG 1 cut(s) 84
FaeI CATG 1 cut(s) 20
FaiI YATR 1 cut(s) 18
FatI CATG 1 cut(s) 16
FauI CCCGC 1 cut(s) 68
FokI GGATG 2 cut(s) 68, 101
HaeIII GGCC 1 cut(s) 158
Hin1II CATG 1 cut(s) 20
HinfI GANTC 1 cut(s) 146
Hpy188I TCNGA 1 cut(s) 151
Hpy188III TCNNGA 1 cut(s) 76
HpyAV CCTTC 4 cut(s) 42, 44, 46, 148
HpyCH4V TGCA 1 cut(s) 44
Hsp92II CATG 1 cut(s) 20
Kzo9I GATC 2 cut(s) 12, 21
LmnI GCTCC 1 cut(s) 119
LweI GCATC 2 cut(s) 46, 79
MalI GATC 2 cut(s) 14, 23
MboI GATC 2 cut(s) 12, 21
MflI RGATCY 1 cut(s) 12
MhlI GDGCHC 1 cut(s) 116
MnlI CCTC 1 cut(s) 72
NdeII GATC 2 cut(s) 12, 21
NlaIII CATG 1 cut(s) 20
PfeI GAWTC 1 cut(s) 146
PspPI GGNCC 1 cut(s) 81
PsuI RGATCY 1 cut(s) 12
RsaI GTAC 1 cut(s) 122
RsaNI GTAC 1 cut(s) 121
Sau3AI GATC 2 cut(s) 12, 21
Sau96I GGNCC 1 cut(s) 81
SduI GDGCHC 1 cut(s) 116
SetI ASST 2 cut(s) 108, 126
SfaNI GCATC 2 cut(s) 46, 79
SinI GGWCC 1 cut(s) 81
SsiI CCGC 1 cut(s) 61
StyI CCWWGG 1 cut(s) 84
TfiI GAWTC 1 cut(s) 146
VpaK11BI GGWCC 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.