Rmu_co8253789.1_g000001

Belongs to the eukaryotic ribosomal protein eL38 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8253789.1
Physical Location & Seq
Forward (+)
1 .. 374
374 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8253789.1_g000001.1.cds

Sequence Viewer

Length: 198 bp
atccatgagatcaaggatttcctcctgactgcaagaaggaaggatgcccgttctgtgaaaatcaagaagacgaaggacgcagtcaagttcaaggttcgatgctccaagtacctttacacactttgtgtgtttgatactgagaaggctgataagttgaagcaatcccttcctccaggtttgagcgtccaggatctgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

7.53

Weight (kDa)

9.78

Isoelectric Point (pI)

34.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AdeI CACNNNGTG 1 cut(s) 125
AfaI GTAC 1 cut(s) 110
AgsI TTSAA 2 cut(s) 91, 157
AjnI CCWGG 2 cut(s) 172, 186
AlwNI CAGNNNCTG 1 cut(s) 193
BbsI GAAGAC 1 cut(s) 74
BciT130I CCWGG 2 cut(s) 174, 188
Bme1390I CCNGG 2 cut(s) 174, 188
BmrFI CCNGG 2 cut(s) 174, 188
BmsI GCATC 2 cut(s) 34, 89
BpiI GAAGAC 1 cut(s) 74
BpmI CTGGAG 1 cut(s) 156
BseBI CCWGG 2 cut(s) 174, 188
BseGI GGATG 1 cut(s) 49
BseMII CTCAG 1 cut(s) 129
Bsp143I GATC 2 cut(s) 9, 190
BspCNI CTCAG 1 cut(s) 130
BssMI GATC 2 cut(s) 9, 190
Bst2UI CCWGG 2 cut(s) 174, 188
BstDEI CTNAG 1 cut(s) 138
BstF5I GGATG 1 cut(s) 49
BstKTI GATC 2 cut(s) 12, 193
BstMBI GATC 2 cut(s) 9, 190
BstNI CCWGG 2 cut(s) 174, 188
BstSCI CCNGG 2 cut(s) 172, 186
BstV2I GAAGAC 1 cut(s) 74
BstX2I RGATCY 1 cut(s) 190
BstYI RGATCY 1 cut(s) 190
BtsCI GGATG 1 cut(s) 49
CaiI CAGNNNCTG 1 cut(s) 193
CseI GACGC 2 cut(s) 86, 172
Csp6I GTAC 1 cut(s) 109
CviAII CATG 1 cut(s) 5
CviJI RGCY 1 cut(s) 146
CviKI_1 RGCY 1 cut(s) 146
CviQI GTAC 1 cut(s) 109
DdeI CTNAG 1 cut(s) 138
DpnI GATC 2 cut(s) 11, 192
DpnII GATC 2 cut(s) 9, 190
DraIII CACNNNGTG 1 cut(s) 125
EcoRII CCWGG 2 cut(s) 172, 186
FaeI CATG 1 cut(s) 8
FaiI YATR 1 cut(s) 6
FatI CATG 1 cut(s) 4
FokI GGATG 1 cut(s) 56
GsuI CTGGAG 1 cut(s) 156
HgaI GACGC 2 cut(s) 86, 172
Hin1II CATG 1 cut(s) 8
Hpy188III TCNNGA 2 cut(s) 25, 64
HpyAV CCTTC 5 cut(s) 30, 34, 67, 136, 176
HpyCH4V TGCA 1 cut(s) 32
HpyF3I CTNAG 1 cut(s) 138
Hsp92II CATG 1 cut(s) 8
Kzo9I GATC 2 cut(s) 9, 190
LmnI GCTCC 1 cut(s) 107
LpnPI CCDG 4 cut(s) 38, 159, 173, 186
LweI GCATC 2 cut(s) 34, 89
MalI GATC 2 cut(s) 11, 192
MboI GATC 2 cut(s) 9, 190
MboII GAAGA 1 cut(s) 79
MflI RGATCY 1 cut(s) 190
MnlI CCTC 2 cut(s) 32, 180
MspR9I CCNGG 2 cut(s) 174, 188
MvaI CCWGG 2 cut(s) 174, 188
NdeII GATC 2 cut(s) 9, 190
NlaIII CATG 1 cut(s) 8
PflFI GACNNNGTC 1 cut(s) 80
PfoI TCCNGGA 1 cut(s) 186
Psp6I CCWGG 2 cut(s) 172, 186
PspGI CCWGG 2 cut(s) 172, 186
PstNI CAGNNNCTG 1 cut(s) 193
PsuI RGATCY 1 cut(s) 190
PsyI GACNNNGTC 1 cut(s) 80
RsaI GTAC 1 cut(s) 110
RsaNI GTAC 1 cut(s) 109
Sau3AI GATC 2 cut(s) 9, 190
ScrFI CCNGG 2 cut(s) 174, 188
SetI ASST 3 cut(s) 96, 114, 178
SfaNI GCATC 2 cut(s) 34, 89
StyD4I CCNGG 2 cut(s) 172, 186
TaqI TCGA 1 cut(s) 97
Tth111I GACNNNGTC 1 cut(s) 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.