Rh6DG159700

Belongs to the eukaryotic ribosomal protein eL38 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
OG0001881
Physical Location & Seq
Reverse (-)
23835080 .. 23838381
3302 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG159700.1

Sequence Viewer

Length: 222 bp
ATGCCGAAGCAAATCCATGAGATCAAGGATTTCCTCCTGACTGCAAGAAGGAAGGATGCCCGTTCTGTGAAAATCAAGAAGACGAAGGACGCAGTCAAGTTCAAGTTTATGGCATCTACTTTGTACAAATCAAAATTAGAGAAAGTCCTTAAAAAATCTGAGGTCTCAAGGAATGCAGGCAGTTGGGTTAAGATTCTGCAAGTCAATCTGAAAGATTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L38e

Protein Analysis

73

Amino Acids

8.5

Weight (kDa)

10.37

Isoelectric Point (pI)

37.3

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L38e PF01781 2 - 37 7.9e-13 Ribosomal L38e protein family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 220
AfaI GTAC 1 cut(s) 125
AgsI TTSAA 1 cut(s) 103
Alw26I GTCTC 1 cut(s) 169
BbsI GAAGAC 1 cut(s) 86
BcoDI GTCTC 1 cut(s) 169
BmsI GCATC 2 cut(s) 46, 122
BpiI GAAGAC 1 cut(s) 86
BpuEI CTTGAG 1 cut(s) 151
BsaI GGTCTC 1 cut(s) 169
BseGI GGATG 1 cut(s) 61
BseMII CTCAG 1 cut(s) 150
BsmAI GTCTC 1 cut(s) 169
BsmI GAATGC 1 cut(s) 178
Bso31I GGTCTC 1 cut(s) 169
Bsp1407I TGTACA 1 cut(s) 123
Bsp143I GATC 1 cut(s) 21
BspCNI CTCAG 1 cut(s) 151
BspTNI GGTCTC 1 cut(s) 169
BsrGI TGTACA 1 cut(s) 123
BssMI GATC 1 cut(s) 21
BstAUI TGTACA 1 cut(s) 123
BstC8I GCNNGC 1 cut(s) 178
BstDEI CTNAG 1 cut(s) 159
BstF5I GGATG 1 cut(s) 61
BstKTI GATC 1 cut(s) 24
BstMAI GTCTC 1 cut(s) 169
BstMBI GATC 1 cut(s) 21
BstV2I GAAGAC 1 cut(s) 86
BtsCI GGATG 1 cut(s) 61
Cac8I GCNNGC 1 cut(s) 178
CseI GACGC 1 cut(s) 98
Csp6I GTAC 1 cut(s) 124
CviAII CATG 1 cut(s) 17
CviQI GTAC 1 cut(s) 124
DdeI CTNAG 1 cut(s) 159
DpnI GATC 1 cut(s) 23
DpnII GATC 1 cut(s) 21
Eco31I GGTCTC 1 cut(s) 169
FaeI CATG 1 cut(s) 20
FaiI YATR 3 cut(s) 18, 110, 220
FatI CATG 1 cut(s) 16
FokI GGATG 1 cut(s) 68
HgaI GACGC 1 cut(s) 98
Hin1II CATG 1 cut(s) 20
HinfI GANTC 1 cut(s) 193
Hpy188I TCNGA 2 cut(s) 160, 210
Hpy188III TCNNGA 2 cut(s) 37, 76
HpyAV CCTTC 3 cut(s) 42, 46, 79
HpyCH4V TGCA 3 cut(s) 44, 176, 199
HpyF3I CTNAG 1 cut(s) 159
Hsp92II CATG 1 cut(s) 20
Kzo9I GATC 1 cut(s) 21
LpnPI CCDG 2 cut(s) 50, 162
LweI GCATC 2 cut(s) 46, 122
MalI GATC 1 cut(s) 23
MboI GATC 1 cut(s) 21
MboII GAAGA 1 cut(s) 91
MluCI AATT 1 cut(s) 134
MnlI CCTC 2 cut(s) 44, 154
MseI TTAA 2 cut(s) 150, 189
Mva1269I GAATGC 1 cut(s) 178
NdeII GATC 1 cut(s) 21
NlaIII CATG 1 cut(s) 20
PctI GAATGC 1 cut(s) 178
PfeI GAWTC 1 cut(s) 193
PflFI GACNNNGTC 1 cut(s) 92
PsiI TTATAA 1 cut(s) 220
PsyI GACNNNGTC 1 cut(s) 92
RsaI GTAC 1 cut(s) 125
RsaNI GTAC 1 cut(s) 124
SaqAI TTAA 2 cut(s) 150, 189
Sau3AI GATC 1 cut(s) 21
SetI ASST 1 cut(s) 165
SfaNI GCATC 2 cut(s) 46, 122
SmlI CTYRAG 1 cut(s) 166
SmoI CTYRAG 1 cut(s) 166
Sse9I AATT 1 cut(s) 134
TasI AATT 1 cut(s) 134
TatI WGTACW 1 cut(s) 123
TfiI GAWTC 1 cut(s) 193
Tru1I TTAA 2 cut(s) 150, 189
Tru9I TTAA 2 cut(s) 150, 189
Tth111I GACNNNGTC 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.