Rh5CG368600

Belongs to the eukaryotic ribosomal protein eL38 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0001881
Physical Location & Seq
Forward (+)
46842965 .. 46845394
2430 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG368600.1

Sequence Viewer

Length: 219 bp
ATGCTGCCGAAGCAAATCCATGAGATCAAGGATTTCCTCTTGACTGCAAGAAGGAAGGATGCCCATTCTGTGAAAATCAAGAAGACGAAGGACGCAGTCAAGTTCAAGGTTCGATGCAACCTTTTCTTTATTACTATTAAGGAAGTTTTTGCAACTCGTATTTCTGGATCTGCTGACCTTTACAAATGCATGGGAATTTGCCTTCTCAAAGCCAGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L38e

Protein Analysis

72

Amino Acids

8.26

Weight (kDa)

9.97

Isoelectric Point (pI)

20.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L38e PF01781 3 - 46 1.6e-17 Ribosomal L38e protein family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 175
AcsI RAATTY 1 cut(s) 195
AgsI TTSAA 1 cut(s) 106
AlwI GGATC 1 cut(s) 175
ApeKI GCWGC 1 cut(s) 4
ApoI RAATTY 1 cut(s) 195
BbsI GAAGAC 1 cut(s) 89
BisI GCNGC 1 cut(s) 5
BlsI GCNGC 1 cut(s) 6
BmsI GCATC 2 cut(s) 49, 104
BpiI GAAGAC 1 cut(s) 89
Bse1I ACTGG 1 cut(s) 213
BseGI GGATG 1 cut(s) 64
BseNI ACTGG 1 cut(s) 213
Bsp143I GATC 2 cut(s) 24, 167
BspPI GGATC 1 cut(s) 175
BsrI ACTGG 1 cut(s) 213
BssMI GATC 2 cut(s) 24, 167
BstF5I GGATG 1 cut(s) 64
BstKTI GATC 2 cut(s) 27, 170
BstMBI GATC 2 cut(s) 24, 167
BstMWI GCNNNNNNNGC 1 cut(s) 10
BstV2I GAAGAC 1 cut(s) 89
BstX2I RGATCY 1 cut(s) 167
BstYI RGATCY 1 cut(s) 167
BtsCI GGATG 1 cut(s) 64
CseI GACGC 1 cut(s) 101
CviAII CATG 2 cut(s) 20, 190
CviJI RGCY 1 cut(s) 212
CviKI_1 RGCY 1 cut(s) 212
DpnI GATC 2 cut(s) 26, 169
DpnII GATC 2 cut(s) 24, 167
EcoT22I ATGCAT 1 cut(s) 191
FaeI CATG 2 cut(s) 23, 193
FaiI YATR 2 cut(s) 21, 191
FatI CATG 2 cut(s) 19, 189
Fnu4HI GCNGC 1 cut(s) 5
FokI GGATG 1 cut(s) 71
Fsp4HI GCNGC 1 cut(s) 5
GluI GCNGC 1 cut(s) 5
HgaI GACGC 1 cut(s) 101
Hin1II CATG 2 cut(s) 23, 193
Hpy188III TCNNGA 3 cut(s) 40, 79, 165
HpyAV CCTTC 4 cut(s) 45, 49, 82, 212
HpyCH4V TGCA 4 cut(s) 47, 117, 152, 189
HpyF10VI GCNNNNNNNGC 1 cut(s) 10
Hsp92II CATG 2 cut(s) 23, 193
Kzo9I GATC 2 cut(s) 24, 167
LpnPI CCDG 1 cut(s) 150
LweI GCATC 2 cut(s) 49, 104
MalI GATC 2 cut(s) 26, 169
MboI GATC 2 cut(s) 24, 167
MboII GAAGA 1 cut(s) 94
MflI RGATCY 1 cut(s) 167
MluCI AATT 1 cut(s) 195
MnlI CCTC 1 cut(s) 47
Mph1103I ATGCAT 1 cut(s) 191
MseI TTAA 1 cut(s) 138
MwoI GCNNNNNNNGC 1 cut(s) 10
NdeII GATC 2 cut(s) 24, 167
NlaIII CATG 2 cut(s) 23, 193
NsiI ATGCAT 1 cut(s) 191
PflFI GACNNNGTC 1 cut(s) 95
PkrI GCNGC 1 cut(s) 6
PsuI RGATCY 1 cut(s) 167
PsyI GACNNNGTC 1 cut(s) 95
SaqAI TTAA 1 cut(s) 138
SatI GCNGC 1 cut(s) 5
Sau3AI GATC 2 cut(s) 24, 167
SetI ASST 3 cut(s) 111, 123, 180
SfaNI GCATC 2 cut(s) 49, 104
Sse9I AATT 1 cut(s) 195
TaqI TCGA 1 cut(s) 112
TasI AATT 1 cut(s) 195
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
TseI GCWGC 1 cut(s) 4
Tth111I GACNNNGTC 1 cut(s) 95
XapI RAATTY 1 cut(s) 195
Zsp2I ATGCAT 1 cut(s) 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.