MD04G1045900.v1.1

Belongs to the eukaryotic ribosomal protein eL38 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr04
OG0001881
Physical Location & Seq
Reverse (-)
5325125 .. 5327065
1941 bp
Loading structure...
UTR
Exon/CDS
Intron
MD04G1045900.v1.1.491

Sequence Viewer

Length: 210 bp
ATGCCTAAGCAAATCCATGAAATTAAGGATTTCCTTCTCACTGCAAGAAGGAAAGACGCACGCTCTGTGAAGATCAAGAAGACCAAAGATGCGGTGAAGTTCAAGGTTCGATGCTCCAAGTACCTTTACACACTTTGTGTTTTTGACACAGAGAAGGCTGATAAGCTTAAGCAGTCTCTCCCTCCAGGTTTGAATGTGCAAGACCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L38e

Protein Analysis

70

Amino Acids

8.02

Weight (kDa)

9.85

Isoelectric Point (pI)

43.2

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L38e PF01781 2 - 67 2.5e-35 Ribosomal L38e protein family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 92
AdeI CACNNNGTG 1 cut(s) 137
AfaI GTAC 1 cut(s) 122
AflII CTTAAG 1 cut(s) 167
AgsI TTSAA 2 cut(s) 103, 193
AjnI CCWGG 1 cut(s) 184
AluBI AGCT 1 cut(s) 166
AluI AGCT 1 cut(s) 166
Alw26I GTCTC 1 cut(s) 180
AsuHPI GGTGA 1 cut(s) 106
BbsI GAAGAC 1 cut(s) 86
BciT130I CCWGG 1 cut(s) 186
BcoDI GTCTC 1 cut(s) 180
BfrI CTTAAG 1 cut(s) 167
Bme1390I CCNGG 1 cut(s) 186
BmrFI CCNGG 1 cut(s) 186
BmsI GCATC 2 cut(s) 79, 101
BpiI GAAGAC 1 cut(s) 86
BpmI CTGGAG 1 cut(s) 168
Bpu10I CCTNAGC 1 cut(s) 6
BseBI CCWGG 1 cut(s) 186
BsmAI GTCTC 1 cut(s) 180
Bsp143I GATC 1 cut(s) 72
BspACI CCGC 1 cut(s) 92
BspTI CTTAAG 1 cut(s) 167
BssMI GATC 1 cut(s) 72
Bst2UI CCWGG 1 cut(s) 186
BstAFI CTTAAG 1 cut(s) 167
BstC8I GCNNGC 1 cut(s) 61
BstDEI CTNAG 1 cut(s) 6
BstKTI GATC 1 cut(s) 75
BstMAI GTCTC 1 cut(s) 180
BstMBI GATC 1 cut(s) 72
BstNI CCWGG 1 cut(s) 186
BstSCI CCNGG 1 cut(s) 184
BstV2I GAAGAC 1 cut(s) 86
BtsI GCAGTG 1 cut(s) 39
BtsIMutI CAGTG 1 cut(s) 39
Cac8I GCNNGC 1 cut(s) 61
CseI GACGC 1 cut(s) 65
Csp6I GTAC 1 cut(s) 121
CviAII CATG 1 cut(s) 17
CviJI RGCY 2 cut(s) 158, 166
CviKI_1 RGCY 2 cut(s) 158, 166
CviQI GTAC 1 cut(s) 121
DdeI CTNAG 1 cut(s) 6
DpnI GATC 1 cut(s) 74
DpnII GATC 1 cut(s) 72
DraIII CACNNNGTG 1 cut(s) 137
EcoRII CCWGG 1 cut(s) 184
FaeI CATG 1 cut(s) 20
FaiI YATR 1 cut(s) 18
FatI CATG 1 cut(s) 16
GsuI CTGGAG 1 cut(s) 168
HgaI GACGC 1 cut(s) 65
Hin1II CATG 1 cut(s) 20
HindIII AAGCTT 1 cut(s) 164
HphI GGTGA 1 cut(s) 106
Hpy188III TCNNGA 1 cut(s) 76
HpyAV CCTTC 3 cut(s) 42, 44, 148
HpyCH4V TGCA 2 cut(s) 44, 199
HpyF3I CTNAG 1 cut(s) 6
Hsp92II CATG 1 cut(s) 20
Kzo9I GATC 1 cut(s) 72
LmnI GCTCC 1 cut(s) 119
LpnPI CCDG 2 cut(s) 171, 198
LweI GCATC 2 cut(s) 79, 101
MalI GATC 1 cut(s) 74
MboI GATC 1 cut(s) 72
MboII GAAGA 2 cut(s) 82, 91
MluCI AATT 1 cut(s) 21
MnlI CCTC 1 cut(s) 192
MseI TTAA 2 cut(s) 24, 168
MspCI CTTAAG 1 cut(s) 167
MspR9I CCNGG 1 cut(s) 186
MvaI CCWGG 1 cut(s) 186
NdeII GATC 1 cut(s) 72
NlaIII CATG 1 cut(s) 20
Psp6I CCWGG 1 cut(s) 184
PspGI CCWGG 1 cut(s) 184
RsaI GTAC 1 cut(s) 122
RsaNI GTAC 1 cut(s) 121
SaqAI TTAA 2 cut(s) 24, 168
Sau3AI GATC 1 cut(s) 72
ScrFI CCNGG 1 cut(s) 186
SetI ASST 4 cut(s) 108, 126, 168, 190
SfaNI GCATC 2 cut(s) 79, 101
SgeI CNNG 8 cut(s) 29, 57, 72, 88, 115, 130, 197, 198
SmlI CTYRAG 1 cut(s) 167
SmoI CTYRAG 1 cut(s) 167
Sse9I AATT 1 cut(s) 21
SsiI CCGC 1 cut(s) 92
StyD4I CCNGG 1 cut(s) 184
TaqI TCGA 1 cut(s) 109
TasI AATT 1 cut(s) 21
Tru1I TTAA 2 cut(s) 24, 168
Tru9I TTAA 2 cut(s) 24, 168
TscAI CASTG 1 cut(s) 46
TspDTI ATGAA 1 cut(s) 33
TspRI CASTG 1 cut(s) 46
Vha464I CTTAAG 1 cut(s) 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.