MD12G1262900.v1.1

Belongs to the eukaryotic ribosomal protein eL38 family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr12
Physical Location & Seq
Reverse (-)
32955248 .. 32957239
1992 bp
Loading structure...
UTR
Exon/CDS
Intron
MD12G1262900.v1.1.491

Sequence Viewer

Length: 210 bp
ATGCCGAAGCAGATCCATGAGATTAAGGATTTCCTTCTAACCGCAAGAAGGAAGGATGCCCGCAATGTCAAAATCAAGAGGACCAAGGATGCTGTTAAGTTCAAGGTTCGGTGCTCCAAGTACCTTTACACACTTTGTGTGTTTGATTCCGACAAGGCCAACAAGTTGAAGCAATCTCTTCCTCCAGGTTTGAACGTTCAGGATCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

8.05

Weight (kDa)

10.02

Isoelectric Point (pI)

50.18

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L38e PF01781 2 - 67 2.2e-34 Ribosomal L38e protein family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 42, 61
AclI AACGTT 1 cut(s) 195
AclWI GGATC 2 cut(s) 7, 197
AdeI CACNNNGTG 1 cut(s) 137
AfaI GTAC 1 cut(s) 122
AfiI CCNNNNNNNGG 1 cut(s) 48
AgsI TTSAA 3 cut(s) 103, 169, 193
AjnI CCWGG 1 cut(s) 184
Alw21I GWGCWC 1 cut(s) 116
AlwI GGATC 2 cut(s) 7, 197
AoxI GGCC 1 cut(s) 156
AspS9I GGNCC 1 cut(s) 81
AvaII GGWCC 1 cut(s) 81
BamHI GGATCC 1 cut(s) 202
Bbv12I GWGCWC 1 cut(s) 116
BciT130I CCWGG 1 cut(s) 186
Bme1390I CCNGG 1 cut(s) 186
Bme18I GGWCC 1 cut(s) 81
BmgT120I GGNCC 1 cut(s) 81
BmiI GGNNCC 1 cut(s) 204
BmrFI CCNGG 1 cut(s) 186
BmsI GCATC 2 cut(s) 46, 79
BpmI CTGGAG 1 cut(s) 168
BsaJI CCNNGG 1 cut(s) 84
Bsc4I CCNNNNNNNGG 1 cut(s) 48
Bse3DI GCAATG 1 cut(s) 70
BseBI CCWGG 1 cut(s) 186
BseDI CCNNGG 1 cut(s) 84
BseGI GGATG 2 cut(s) 61, 94
BseLI CCNNNNNNNGG 1 cut(s) 48
BseMI GCAATG 1 cut(s) 70
BshFI GGCC 1 cut(s) 158
BsiHKAI GWGCWC 1 cut(s) 116
BslI CCNNNNNNNGG 1 cut(s) 48
BsnI GGCC 1 cut(s) 158
Bsp1286I GDGCHC 1 cut(s) 116
Bsp143I GATC 2 cut(s) 12, 202
BspACI CCGC 2 cut(s) 42, 61
BspANI GGCC 1 cut(s) 158
BspLI GGNNCC 1 cut(s) 204
BspPI GGATC 2 cut(s) 7, 197
BsrDI GCAATG 1 cut(s) 70
BssECI CCNNGG 1 cut(s) 84
BssMI GATC 2 cut(s) 12, 202
BssT1I CCWWGG 1 cut(s) 84
Bst2UI CCWGG 1 cut(s) 186
Bst6I CTCTTC 1 cut(s) 183
BstC8I GCNNGC 1 cut(s) 61
BstF5I GGATG 2 cut(s) 61, 94
BstKTI GATC 2 cut(s) 15, 205
BstMBI GATC 2 cut(s) 12, 202
BstNI CCWGG 1 cut(s) 186
BstSCI CCNGG 1 cut(s) 184
BstX2I RGATCY 2 cut(s) 12, 202
BstYI RGATCY 2 cut(s) 12, 202
BsuRI GGCC 1 cut(s) 158
BtsCI GGATG 2 cut(s) 61, 94
Cac8I GCNNGC 1 cut(s) 61
Cfr13I GGNCC 1 cut(s) 81
Csp6I GTAC 1 cut(s) 121
CviAII CATG 1 cut(s) 17
CviJI RGCY 1 cut(s) 158
CviKI_1 RGCY 1 cut(s) 158
CviQI GTAC 1 cut(s) 121
DpnI GATC 2 cut(s) 14, 204
DpnII GATC 2 cut(s) 12, 202
DraIII CACNNNGTG 1 cut(s) 137
Eam1104I CTCTTC 1 cut(s) 183
EarI CTCTTC 1 cut(s) 183
Eco130I CCWWGG 1 cut(s) 84
Eco47I GGWCC 1 cut(s) 81
EcoRII CCWGG 1 cut(s) 184
EcoT14I CCWWGG 1 cut(s) 84
ErhI CCWWGG 1 cut(s) 84
FaeI CATG 1 cut(s) 20
FaiI YATR 1 cut(s) 18
FatI CATG 1 cut(s) 16
FauI CCCGC 1 cut(s) 68
FokI GGATG 2 cut(s) 68, 101
GsuI CTGGAG 1 cut(s) 168
HaeIII GGCC 1 cut(s) 158
Hin1II CATG 1 cut(s) 20
HinfI GANTC 1 cut(s) 146
Hpy188I TCNGA 1 cut(s) 151
Hpy188III TCNNGA 2 cut(s) 76, 200
HpyAV CCTTC 3 cut(s) 42, 44, 46
HpyCH4IV ACGT 1 cut(s) 195
HpySE526I ACGT 1 cut(s) 195
Hsp92II CATG 1 cut(s) 20
Kzo9I GATC 2 cut(s) 12, 202
LmnI GCTCC 1 cut(s) 119
LpnPI CCDG 3 cut(s) 171, 185, 198
LweI GCATC 2 cut(s) 46, 79
MaeII ACGT 1 cut(s) 195
MalI GATC 2 cut(s) 14, 204
MboI GATC 2 cut(s) 12, 202
MboII GAAGA 1 cut(s) 170
MflI RGATCY 2 cut(s) 12, 202
MhlI GDGCHC 1 cut(s) 116
MmeI TCCRAC 1 cut(s) 174
MnlI CCTC 2 cut(s) 72, 192
MseI TTAA 2 cut(s) 24, 96
MspR9I CCNGG 1 cut(s) 186
MvaI CCWGG 1 cut(s) 186
NdeII GATC 2 cut(s) 12, 202
NlaIII CATG 1 cut(s) 20
NlaIV GGNNCC 1 cut(s) 204
PfeI GAWTC 1 cut(s) 146
Psp1406I AACGTT 1 cut(s) 195
Psp6I CCWGG 1 cut(s) 184
PspGI CCWGG 1 cut(s) 184
PspN4I GGNNCC 1 cut(s) 204
PspPI GGNCC 1 cut(s) 81
PsuI RGATCY 2 cut(s) 12, 202
RsaI GTAC 1 cut(s) 122
RsaNI GTAC 1 cut(s) 121
SaqAI TTAA 2 cut(s) 24, 96
Sau3AI GATC 2 cut(s) 12, 202
Sau96I GGNCC 1 cut(s) 81
ScrFI CCNGG 1 cut(s) 186
SduI GDGCHC 1 cut(s) 116
SetI ASST 4 cut(s) 108, 126, 190, 198
SfaNI GCATC 2 cut(s) 46, 79
SinI GGWCC 1 cut(s) 81
SsiI CCGC 2 cut(s) 42, 61
StyD4I CCNGG 1 cut(s) 184
StyI CCWWGG 1 cut(s) 84
TaiI ACGT 1 cut(s) 198
TfiI GAWTC 1 cut(s) 146
Tru1I TTAA 2 cut(s) 24, 96
Tru9I TTAA 2 cut(s) 24, 96
VpaK11BI GGWCC 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.