Rmu_sc0000743.1_g000005

Belongs to the eukaryotic ribosomal protein eL38 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000743.1
Physical Location & Seq
Reverse (-)
26484 .. 27796
1313 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000743.1_g000005.1.cds

Sequence Viewer

Length: 210 bp
atgccgaagcaaatccatgagatcaaggatttcctcctgactgcaagaaggaaggatgcccgttctgtgaaaatcaagaagacgaaggacgcagtcaagttcaaggttcgatgctccaagtacctttacacactttgtgtgtttgatactgagaaggctgataagttgaagcaatcccttcctccaggtttgagcgtccaggatctgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

8.01

Weight (kDa)

9.85

Isoelectric Point (pI)

43.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AdeI CACNNNGTG 1 cut(s) 137
AfaI GTAC 1 cut(s) 122
AgsI TTSAA 2 cut(s) 103, 169
AjnI CCWGG 2 cut(s) 184, 198
AlwNI CAGNNNCTG 1 cut(s) 205
BbsI GAAGAC 1 cut(s) 86
BciT130I CCWGG 2 cut(s) 186, 200
Bme1390I CCNGG 2 cut(s) 186, 200
BmrFI CCNGG 2 cut(s) 186, 200
BmsI GCATC 2 cut(s) 46, 101
BpiI GAAGAC 1 cut(s) 86
BpmI CTGGAG 1 cut(s) 168
BseBI CCWGG 2 cut(s) 186, 200
BseGI GGATG 1 cut(s) 61
BseMII CTCAG 1 cut(s) 141
Bsp143I GATC 2 cut(s) 21, 202
BspCNI CTCAG 1 cut(s) 142
BssMI GATC 2 cut(s) 21, 202
Bst2UI CCWGG 2 cut(s) 186, 200
BstDEI CTNAG 1 cut(s) 150
BstF5I GGATG 1 cut(s) 61
BstKTI GATC 2 cut(s) 24, 205
BstMBI GATC 2 cut(s) 21, 202
BstNI CCWGG 2 cut(s) 186, 200
BstSCI CCNGG 2 cut(s) 184, 198
BstV2I GAAGAC 1 cut(s) 86
BstX2I RGATCY 1 cut(s) 202
BstYI RGATCY 1 cut(s) 202
BtsCI GGATG 1 cut(s) 61
CaiI CAGNNNCTG 1 cut(s) 205
CseI GACGC 2 cut(s) 98, 184
Csp6I GTAC 1 cut(s) 121
CviAII CATG 1 cut(s) 17
CviJI RGCY 1 cut(s) 158
CviKI_1 RGCY 1 cut(s) 158
CviQI GTAC 1 cut(s) 121
DdeI CTNAG 1 cut(s) 150
DpnI GATC 2 cut(s) 23, 204
DpnII GATC 2 cut(s) 21, 202
DraIII CACNNNGTG 1 cut(s) 137
EcoRII CCWGG 2 cut(s) 184, 198
FaeI CATG 1 cut(s) 20
FaiI YATR 1 cut(s) 18
FatI CATG 1 cut(s) 16
FokI GGATG 1 cut(s) 68
GsuI CTGGAG 1 cut(s) 168
HgaI GACGC 2 cut(s) 98, 184
Hin1II CATG 1 cut(s) 20
Hpy188III TCNNGA 2 cut(s) 37, 76
HpyAV CCTTC 5 cut(s) 42, 46, 79, 148, 188
HpyCH4V TGCA 1 cut(s) 44
HpyF3I CTNAG 1 cut(s) 150
Hsp92II CATG 1 cut(s) 20
Kzo9I GATC 2 cut(s) 21, 202
LmnI GCTCC 1 cut(s) 119
LpnPI CCDG 4 cut(s) 50, 171, 185, 198
LweI GCATC 2 cut(s) 46, 101
MalI GATC 2 cut(s) 23, 204
MboI GATC 2 cut(s) 21, 202
MboII GAAGA 1 cut(s) 91
MflI RGATCY 1 cut(s) 202
MnlI CCTC 2 cut(s) 44, 192
MspR9I CCNGG 2 cut(s) 186, 200
MvaI CCWGG 2 cut(s) 186, 200
NdeII GATC 2 cut(s) 21, 202
NlaIII CATG 1 cut(s) 20
PflFI GACNNNGTC 1 cut(s) 92
PfoI TCCNGGA 1 cut(s) 198
Psp6I CCWGG 2 cut(s) 184, 198
PspGI CCWGG 2 cut(s) 184, 198
PstNI CAGNNNCTG 1 cut(s) 205
PsuI RGATCY 1 cut(s) 202
PsyI GACNNNGTC 1 cut(s) 92
RsaI GTAC 1 cut(s) 122
RsaNI GTAC 1 cut(s) 121
Sau3AI GATC 2 cut(s) 21, 202
ScrFI CCNGG 2 cut(s) 186, 200
SetI ASST 3 cut(s) 108, 126, 190
SfaNI GCATC 2 cut(s) 46, 101
StyD4I CCNGG 2 cut(s) 184, 198
TaqI TCGA 1 cut(s) 109
Tth111I GACNNNGTC 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.