Rw5G036920

Belongs to the eukaryotic ribosomal protein eL38 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
OG0001881
Physical Location & Seq
Forward (+)
64899351 .. 64899536
186 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G036920.1

Sequence Viewer

Length: 186 bp
ATGCCGAAGCAAATTCATGAGATCAAGGATTTCCTCCTCACTGCAAGAAGGAAGGACGCCCGTCCTGTCAAAATCAAGAGAACGAAGGATGCTGTGAAGTTCAAGGTTGATTCCGAGGAGGTGGACAAGTTGAAGCATGTTGGAGAGGAAAGATCCCACATTGGAAAAGTGACAAATAAAATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L38e

Protein Analysis

61

Amino Acids

7.14

Weight (kDa)

9.99

Isoelectric Point (pI)

52.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L38e PF01781 2 - 37 6.1e-13 Ribosomal L38e protein family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 147
AcsI RAATTY 1 cut(s) 12
AcyI GRCGYC 1 cut(s) 57
AgsI TTSAA 2 cut(s) 103, 133
AlwI GGATC 1 cut(s) 147
ApoI RAATTY 1 cut(s) 12
BmsI GCATC 1 cut(s) 79
BoxI GACNNNNGTC 1 cut(s) 60
BsaHI GRCGYC 1 cut(s) 57
BsaJI CCNNGG 1 cut(s) 114
BseDI CCNNGG 1 cut(s) 114
BseGI GGATG 1 cut(s) 94
BseRI GAGGAG 2 cut(s) 26, 131
Bsp143I GATC 2 cut(s) 21, 152
BspHI TCATGA 1 cut(s) 16
BspPI GGATC 1 cut(s) 147
BssECI CCNNGG 1 cut(s) 114
BssMI GATC 2 cut(s) 21, 152
BssNI GRCGYC 1 cut(s) 57
BstACI GRCGYC 1 cut(s) 57
BstF5I GGATG 1 cut(s) 94
BstKTI GATC 2 cut(s) 24, 155
BstMBI GATC 2 cut(s) 21, 152
BstNSI RCATGY 1 cut(s) 140
BstPAI GACNNNNGTC 1 cut(s) 60
BstX2I RGATCY 1 cut(s) 152
BstYI RGATCY 1 cut(s) 152
BtsCI GGATG 1 cut(s) 94
BtsI GCAGTG 1 cut(s) 39
BtsIMutI CAGTG 1 cut(s) 39
CciI TCATGA 1 cut(s) 16
CseI GACGC 1 cut(s) 65
CviAII CATG 2 cut(s) 17, 137
DpnI GATC 2 cut(s) 23, 154
DpnII GATC 2 cut(s) 21, 152
FaeI CATG 2 cut(s) 20, 140
FaiI YATR 3 cut(s) 18, 138, 184
FatI CATG 2 cut(s) 16, 136
FokI GGATG 1 cut(s) 101
HgaI GACGC 1 cut(s) 65
Hin1I GRCGYC 1 cut(s) 57
Hin1II CATG 2 cut(s) 20, 140
HinfI GANTC 1 cut(s) 110
Hpy166II GTNNAC 1 cut(s) 124
Hpy188I TCNGA 1 cut(s) 115
Hpy188III TCNNGA 2 cut(s) 17, 76
Hpy8I GTNNAC 1 cut(s) 124
HpyAV CCTTC 3 cut(s) 42, 46, 79
HpyCH4V TGCA 1 cut(s) 44
Hsp92I GRCGYC 1 cut(s) 57
Hsp92II CATG 2 cut(s) 20, 140
Kzo9I GATC 2 cut(s) 21, 152
LpnPI CCDG 1 cut(s) 78
LweI GCATC 1 cut(s) 79
MaeIII GTNAC 1 cut(s) 169
MalI GATC 2 cut(s) 23, 154
MboI GATC 2 cut(s) 21, 152
MflI RGATCY 1 cut(s) 152
MluCI AATT 1 cut(s) 12
MmeI TCCRAC 1 cut(s) 121
MnlI CCTC 5 cut(s) 44, 47, 109, 112, 139
NdeII GATC 2 cut(s) 21, 152
NlaIII CATG 2 cut(s) 20, 140
NmuCI GTSAC 1 cut(s) 169
NspI RCATGY 1 cut(s) 140
PagI TCATGA 1 cut(s) 16
PfeI GAWTC 1 cut(s) 110
PshAI GACNNNNGTC 1 cut(s) 60
PsuI RGATCY 1 cut(s) 152
Sau3AI GATC 2 cut(s) 21, 152
SetI ASST 2 cut(s) 108, 123
SfaNI GCATC 1 cut(s) 79
Sse9I AATT 1 cut(s) 12
TasI AATT 1 cut(s) 12
TfiI GAWTC 1 cut(s) 110
TscAI CASTG 1 cut(s) 46
TseFI GTSAC 1 cut(s) 169
Tsp45I GTSAC 1 cut(s) 169
TspDTI ATGAA 1 cut(s) 5
TspRI CASTG 1 cut(s) 46
XapI RAATTY 1 cut(s) 12
XceI RCATGY 1 cut(s) 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.