MD04G1247500.v1.1

Belongs to the eukaryotic ribosomal protein eL38 family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr04
Physical Location & Seq
Forward (+)
32215092 .. 32217002
1911 bp
Loading structure...
UTR
Exon/CDS
Intron
MD04G1247500.v1.1.491

Sequence Viewer

Length: 210 bp
ATGCCGAAGCAGATCCATGAGATCAAGGATTTCCTTCTAATTGCAAGAAGGAAGGATGCCCGCAATGTCAAAATCAAGAGGACCAAGGATGCTGTCAAGTTCAAGGTTCGGTGCTCCAAGTACCTTTACACACTTTGTGTGTTTGATTCCAAGAAGGCCGACAAGTTGAAGCAATCTCTTCCTCCAGGTCTGAACGTTCAGGACCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

8.07

Weight (kDa)

10.07

Isoelectric Point (pI)

45.52

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L38e PF01781 2 - 67 2.2e-34 Ribosomal L38e protein family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 61
AclI AACGTT 1 cut(s) 195
AclWI GGATC 1 cut(s) 7
AdeI CACNNNGTG 1 cut(s) 137
AfaI GTAC 1 cut(s) 122
AgsI TTSAA 2 cut(s) 103, 169
AjnI CCWGG 1 cut(s) 184
Alw21I GWGCWC 1 cut(s) 116
AlwI GGATC 1 cut(s) 7
AoxI GGCC 1 cut(s) 156
AspS9I GGNCC 2 cut(s) 81, 202
AvaII GGWCC 2 cut(s) 81, 202
Bbv12I GWGCWC 1 cut(s) 116
BciT130I CCWGG 1 cut(s) 186
Bme1390I CCNGG 1 cut(s) 186
Bme18I GGWCC 2 cut(s) 81, 202
BmgT120I GGNCC 2 cut(s) 81, 202
BmiI GGNNCC 1 cut(s) 204
BmrFI CCNGG 1 cut(s) 186
BmsI GCATC 2 cut(s) 46, 79
BpmI CTGGAG 1 cut(s) 168
BsaJI CCNNGG 1 cut(s) 84
Bse3DI GCAATG 1 cut(s) 70
BseBI CCWGG 1 cut(s) 186
BseDI CCNNGG 1 cut(s) 84
BseGI GGATG 2 cut(s) 61, 94
BseMI GCAATG 1 cut(s) 70
BshFI GGCC 1 cut(s) 158
BsiHKAI GWGCWC 1 cut(s) 116
BsnI GGCC 1 cut(s) 158
Bsp1286I GDGCHC 1 cut(s) 116
Bsp143I GATC 2 cut(s) 12, 21
BspACI CCGC 1 cut(s) 61
BspANI GGCC 1 cut(s) 158
BspLI GGNNCC 1 cut(s) 204
BspPI GGATC 1 cut(s) 7
BsrDI GCAATG 1 cut(s) 70
BssECI CCNNGG 1 cut(s) 84
BssMI GATC 2 cut(s) 12, 21
BssT1I CCWWGG 1 cut(s) 84
Bst2UI CCWGG 1 cut(s) 186
Bst6I CTCTTC 1 cut(s) 183
BstC8I GCNNGC 1 cut(s) 61
BstF5I GGATG 2 cut(s) 61, 94
BstKTI GATC 2 cut(s) 15, 24
BstMBI GATC 2 cut(s) 12, 21
BstNI CCWGG 1 cut(s) 186
BstSCI CCNGG 1 cut(s) 184
BstX2I RGATCY 1 cut(s) 12
BstYI RGATCY 1 cut(s) 12
BsuRI GGCC 1 cut(s) 158
BtsCI GGATG 2 cut(s) 61, 94
Cac8I GCNNGC 1 cut(s) 61
Cfr13I GGNCC 2 cut(s) 81, 202
Csp6I GTAC 1 cut(s) 121
CviAII CATG 1 cut(s) 17
CviJI RGCY 1 cut(s) 158
CviKI_1 RGCY 1 cut(s) 158
CviQI GTAC 1 cut(s) 121
DpnI GATC 2 cut(s) 14, 23
DpnII GATC 2 cut(s) 12, 21
DraIII CACNNNGTG 1 cut(s) 137
Eam1104I CTCTTC 1 cut(s) 183
EarI CTCTTC 1 cut(s) 183
Eco130I CCWWGG 1 cut(s) 84
Eco47I GGWCC 2 cut(s) 81, 202
EcoO109I RGGNCCY 1 cut(s) 202
EcoRII CCWGG 1 cut(s) 184
EcoT14I CCWWGG 1 cut(s) 84
ErhI CCWWGG 1 cut(s) 84
FaeI CATG 1 cut(s) 20
FaiI YATR 1 cut(s) 18
FatI CATG 1 cut(s) 16
FauI CCCGC 1 cut(s) 68
FokI GGATG 2 cut(s) 68, 101
GsuI CTGGAG 1 cut(s) 168
HaeIII GGCC 1 cut(s) 158
Hin1II CATG 1 cut(s) 20
HinfI GANTC 1 cut(s) 146
Hpy188I TCNGA 1 cut(s) 192
Hpy188III TCNNGA 2 cut(s) 76, 200
HpyAV CCTTC 4 cut(s) 42, 44, 46, 148
HpyCH4IV ACGT 1 cut(s) 195
HpyCH4V TGCA 1 cut(s) 44
HpySE526I ACGT 1 cut(s) 195
Hsp92II CATG 1 cut(s) 20
Kzo9I GATC 2 cut(s) 12, 21
LmnI GCTCC 1 cut(s) 119
LpnPI CCDG 3 cut(s) 171, 185, 198
LweI GCATC 2 cut(s) 46, 79
MaeII ACGT 1 cut(s) 195
MalI GATC 2 cut(s) 14, 23
MboI GATC 2 cut(s) 12, 21
MboII GAAGA 1 cut(s) 170
MflI RGATCY 1 cut(s) 12
MhlI GDGCHC 1 cut(s) 116
MluCI AATT 1 cut(s) 39
MnlI CCTC 2 cut(s) 72, 192
MspR9I CCNGG 1 cut(s) 186
MvaI CCWGG 1 cut(s) 186
NdeII GATC 2 cut(s) 12, 21
NlaIII CATG 1 cut(s) 20
NlaIV GGNNCC 1 cut(s) 204
PfeI GAWTC 1 cut(s) 146
PpuMI RGGWCCY 1 cut(s) 202
Psp1406I AACGTT 1 cut(s) 195
Psp5II RGGWCCY 1 cut(s) 202
Psp6I CCWGG 1 cut(s) 184
PspGI CCWGG 1 cut(s) 184
PspN4I GGNNCC 1 cut(s) 204
PspPI GGNCC 2 cut(s) 81, 202
PspPPI RGGWCCY 1 cut(s) 202
PsuI RGATCY 1 cut(s) 12
RsaI GTAC 1 cut(s) 122
RsaNI GTAC 1 cut(s) 121
Sau3AI GATC 2 cut(s) 12, 21
Sau96I GGNCC 2 cut(s) 81, 202
ScrFI CCNGG 1 cut(s) 186
SduI GDGCHC 1 cut(s) 116
SetI ASST 4 cut(s) 108, 126, 190, 198
SfaNI GCATC 2 cut(s) 46, 79
SinI GGWCC 2 cut(s) 81, 202
Sse9I AATT 1 cut(s) 39
SsiI CCGC 1 cut(s) 61
StyD4I CCNGG 1 cut(s) 184
StyI CCWWGG 1 cut(s) 84
TaiI ACGT 1 cut(s) 198
TasI AATT 1 cut(s) 39
TfiI GAWTC 1 cut(s) 146
VpaK11BI GGWCC 2 cut(s) 81, 202
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.