Rmu_sc0027627.1_g000001

Belongs to the eukaryotic ribosomal protein eL38 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0027627.1
Physical Location & Seq
Forward (+)
1 .. 635
635 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0027627.1_g000001.1.cds

Sequence Viewer

Length: 360 bp
ccgaagcaaatccatgagatcaaggatttcctcctgactgcaagaaggaaggatgcccgttctgtgaaaatcaagaagacgaaggacgcaatcaagttcaaggttcgatgcaacctttactttattactattaaggaagcttttgcaactcgtatatctggatctcaaatccatgagatcaaggatttcctcttgactgcaagaaggaaggatgcccgttctgtgaaaatcaagaagacgaaggacgcagtcaagttcaaggttggatgcaaccttttctttattactattaaggaagcttttgcaactcgtatttctggatctgctgacctttacaaagtaagcatggctgtttcataa

Protein Analysis

119

Amino Acids

13.64

Weight (kDa)

10.32

Isoelectric Point (pI)

22.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 169, 328
AgsI TTSAA 2 cut(s) 100, 259
AluBI AGCT 2 cut(s) 140, 299
AluI AGCT 2 cut(s) 140, 299
AlwI GGATC 2 cut(s) 169, 328
BbsI GAAGAC 2 cut(s) 83, 242
BmsI GCATC 4 cut(s) 43, 98, 202, 257
BpiI GAAGAC 2 cut(s) 83, 242
BseGI GGATG 3 cut(s) 58, 217, 272
Bsp143I GATC 4 cut(s) 18, 161, 177, 320
BspPI GGATC 2 cut(s) 169, 328
BssMI GATC 4 cut(s) 18, 161, 177, 320
BstF5I GGATG 3 cut(s) 58, 217, 272
BstKTI GATC 4 cut(s) 21, 164, 180, 323
BstMBI GATC 4 cut(s) 18, 161, 177, 320
BstV2I GAAGAC 2 cut(s) 83, 242
BstX2I RGATCY 2 cut(s) 161, 320
BstYI RGATCY 2 cut(s) 161, 320
BtsCI GGATG 3 cut(s) 58, 217, 272
CseI GACGC 2 cut(s) 95, 254
CviAII CATG 3 cut(s) 14, 173, 346
CviJI RGCY 3 cut(s) 140, 299, 350
CviKI_1 RGCY 3 cut(s) 140, 299, 350
DpnI GATC 4 cut(s) 20, 163, 179, 322
DpnII GATC 4 cut(s) 18, 161, 177, 320
FaeI CATG 3 cut(s) 17, 176, 349
FaiI YATR 5 cut(s) 15, 155, 174, 347, 358
FatI CATG 3 cut(s) 13, 172, 345
FokI GGATG 3 cut(s) 65, 224, 279
HgaI GACGC 2 cut(s) 95, 254
Hin1II CATG 3 cut(s) 17, 176, 349
HindIII AAGCTT 2 cut(s) 138, 297
Hpy188III TCNNGA 6 cut(s) 34, 73, 159, 193, 232, 318
HpyAV CCTTC 6 cut(s) 39, 43, 76, 198, 202, 235
HpyCH4V TGCA 6 cut(s) 41, 111, 146, 200, 270, 305
Hsp92II CATG 3 cut(s) 17, 176, 349
Kzo9I GATC 4 cut(s) 18, 161, 177, 320
LpnPI CCDG 3 cut(s) 47, 144, 303
LweI GCATC 4 cut(s) 43, 98, 202, 257
MalI GATC 4 cut(s) 20, 163, 179, 322
MboI GATC 4 cut(s) 18, 161, 177, 320
MboII GAAGA 2 cut(s) 88, 247
MflI RGATCY 2 cut(s) 161, 320
MmeI TCCRAC 1 cut(s) 244
MnlI CCTC 2 cut(s) 41, 200
MseI TTAA 2 cut(s) 132, 291
NdeII GATC 4 cut(s) 18, 161, 177, 320
NlaIII CATG 3 cut(s) 17, 176, 349
PflFI GACNNNGTC 1 cut(s) 248
PsuI RGATCY 2 cut(s) 161, 320
PsyI GACNNNGTC 1 cut(s) 248
SaqAI TTAA 2 cut(s) 132, 291
Sau3AI GATC 4 cut(s) 18, 161, 177, 320
SetI ASST 7 cut(s) 105, 117, 142, 264, 276, 301, 333
SfaNI GCATC 4 cut(s) 43, 98, 202, 257
TaqI TCGA 1 cut(s) 106
Tru1I TTAA 2 cut(s) 132, 291
Tru9I TTAA 2 cut(s) 132, 291
TspDTI ATGAA 1 cut(s) 345
Tth111I GACNNNGTC 1 cut(s) 248
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.