Rh6CG167700

Belongs to the eukaryotic ribosomal protein eL38 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0001881
Physical Location & Seq
Reverse (-)
22733232 .. 22734928
1697 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG167700.1

Sequence Viewer

Length: 264 bp
ATGCCGAAGCAAATCCATGAGATCAAGGATTTCCTCCTGACTGCAAGAAGGAAGGATGCCCGTTCTGTGAAAATCAAGAAGACGAAGGACGCAGTCAAGTTCAAGGTTCGATGCTCCAAGTACCTTTACACACTTTGTGTGTTTGATACTGAGAAGGCCGATAAGTTGAAGCAATCCCTTCCTCCAGGTATGCTTTTATCGTTTATTTGTGCCATTTATTTTGGACTTTTACTATTAACTGTTTTATATCTGATTGCTTCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L38e

Protein Analysis

87

Amino Acids

10.03

Weight (kDa)

9.78

Isoelectric Point (pI)

34.11

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L38e PF01781 2 - 64 1.1e-33 Ribosomal L38e protein family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AdeI CACNNNGTG 1 cut(s) 137
AfaI GTAC 1 cut(s) 122
AgsI TTSAA 2 cut(s) 103, 169
AjnI CCWGG 1 cut(s) 184
AoxI GGCC 1 cut(s) 156
BbsI GAAGAC 1 cut(s) 86
BciT130I CCWGG 1 cut(s) 186
Bme1390I CCNGG 1 cut(s) 186
BmrFI CCNGG 1 cut(s) 186
BmsI GCATC 2 cut(s) 46, 101
BpiI GAAGAC 1 cut(s) 86
BpmI CTGGAG 1 cut(s) 168
BseBI CCWGG 1 cut(s) 186
BseGI GGATG 1 cut(s) 61
BseMII CTCAG 1 cut(s) 141
BshFI GGCC 1 cut(s) 158
BsnI GGCC 1 cut(s) 158
Bsp143I GATC 1 cut(s) 21
BspANI GGCC 1 cut(s) 158
BspCNI CTCAG 1 cut(s) 142
BssMI GATC 1 cut(s) 21
Bst2UI CCWGG 1 cut(s) 186
Bst4CI ACNGT 1 cut(s) 241
BstDEI CTNAG 1 cut(s) 150
BstF5I GGATG 1 cut(s) 61
BstKTI GATC 1 cut(s) 24
BstMBI GATC 1 cut(s) 21
BstNI CCWGG 1 cut(s) 186
BstSCI CCNGG 1 cut(s) 184
BstV2I GAAGAC 1 cut(s) 86
BsuRI GGCC 1 cut(s) 158
BtsCI GGATG 1 cut(s) 61
CseI GACGC 1 cut(s) 98
Csp6I GTAC 1 cut(s) 121
CviAII CATG 1 cut(s) 17
CviJI RGCY 1 cut(s) 158
CviKI_1 RGCY 1 cut(s) 158
CviQI GTAC 1 cut(s) 121
DdeI CTNAG 1 cut(s) 150
DpnI GATC 1 cut(s) 23
DpnII GATC 1 cut(s) 21
DraIII CACNNNGTG 1 cut(s) 137
EcoRII CCWGG 1 cut(s) 184
FaeI CATG 1 cut(s) 20
FaiI YATR 3 cut(s) 18, 191, 247
FatI CATG 1 cut(s) 16
FokI GGATG 1 cut(s) 68
GsuI CTGGAG 1 cut(s) 168
HaeIII GGCC 1 cut(s) 158
HgaI GACGC 1 cut(s) 98
Hin1II CATG 1 cut(s) 20
Hpy188I TCNGA 1 cut(s) 252
Hpy188III TCNNGA 3 cut(s) 37, 76, 261
HpyAV CCTTC 5 cut(s) 42, 46, 79, 148, 188
HpyCH4III ACNGT 1 cut(s) 241
HpyCH4V TGCA 1 cut(s) 44
HpyF3I CTNAG 1 cut(s) 150
Hsp92II CATG 1 cut(s) 20
Kzo9I GATC 1 cut(s) 21
LmnI GCTCC 1 cut(s) 119
LpnPI CCDG 3 cut(s) 50, 171, 198
LweI GCATC 2 cut(s) 46, 101
MalI GATC 1 cut(s) 23
MboI GATC 1 cut(s) 21
MboII GAAGA 1 cut(s) 91
MnlI CCTC 2 cut(s) 44, 192
MseI TTAA 1 cut(s) 236
MspR9I CCNGG 1 cut(s) 186
MvaI CCWGG 1 cut(s) 186
NdeII GATC 1 cut(s) 21
NlaIII CATG 1 cut(s) 20
PflFI GACNNNGTC 1 cut(s) 92
Psp6I CCWGG 1 cut(s) 184
PspGI CCWGG 1 cut(s) 184
PsyI GACNNNGTC 1 cut(s) 92
RsaI GTAC 1 cut(s) 122
RsaNI GTAC 1 cut(s) 121
SaqAI TTAA 1 cut(s) 236
Sau3AI GATC 1 cut(s) 21
ScrFI CCNGG 1 cut(s) 186
SetI ASST 3 cut(s) 108, 126, 190
SfaNI GCATC 2 cut(s) 46, 101
StyD4I CCNGG 1 cut(s) 184
TaaI ACNGT 1 cut(s) 241
TaqI TCGA 1 cut(s) 109
Tru1I TTAA 1 cut(s) 236
Tru9I TTAA 1 cut(s) 236
Tth111I GACNNNGTC 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.