RchiOBHm_Chr3g0447551

Belongs to the eukaryotic ribosomal protein eL38 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
223896 .. 225522
1627 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ41501

Sequence Viewer

Length: 210 bp
ATGCCGAAGCAAATTCACGAGATCAAGGATTTCCTCCTTACTGCAAGAAGGAAGGATGCGCGTTCTGTCAAAATCAAGAGAACGAAGGACGCTGTGAAGTTCAAGGTTCGGTGCTCAAAGTACCTCTACACCCTTTGCGTGTTTGATTCCGAGAAGGCAGACAAGTTGAAGCAATCTCTTCCTCCAGGCTTGAGCGTGCAGGACCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

8.02

Weight (kDa)

9.9

Isoelectric Point (pI)

52.89

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L38e PF01781 2 - 68 2.3e-35 Ribosomal L38e protein family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 61
AcsI RAATTY 1 cut(s) 12
AfaI GTAC 1 cut(s) 122
AgsI TTSAA 2 cut(s) 103, 169
AjnI CCWGG 1 cut(s) 184
Alw21I GWGCWC 1 cut(s) 116
AlwNI CAGNNNCTG 1 cut(s) 205
ApoI RAATTY 1 cut(s) 12
AspLEI GCGC 1 cut(s) 61
AspS9I GGNCC 1 cut(s) 202
AvaII GGWCC 1 cut(s) 202
BauI CACGAG 1 cut(s) 17
Bbv12I GWGCWC 1 cut(s) 116
BciT130I CCWGG 1 cut(s) 186
Bme1390I CCNGG 1 cut(s) 186
Bme18I GGWCC 1 cut(s) 202
BmgT120I GGNCC 1 cut(s) 202
BmrFI CCNGG 1 cut(s) 186
BmsI GCATC 1 cut(s) 46
BpmI CTGGAG 1 cut(s) 168
BseBI CCWGG 1 cut(s) 186
BseGI GGATG 1 cut(s) 61
Bsh1236I CGCG 1 cut(s) 61
BsiHKAI GWGCWC 1 cut(s) 116
Bsp1286I GDGCHC 1 cut(s) 116
Bsp143I GATC 1 cut(s) 21
BspFNI CGCG 1 cut(s) 61
BssMI GATC 1 cut(s) 21
BssSI CACGAG 1 cut(s) 17
Bst2BI CACGAG 1 cut(s) 17
Bst2UI CCWGG 1 cut(s) 186
Bst6I CTCTTC 1 cut(s) 183
BstC8I GCNNGC 1 cut(s) 197
BstF5I GGATG 1 cut(s) 61
BstFNI CGCG 1 cut(s) 61
BstHHI GCGC 1 cut(s) 61
BstKTI GATC 1 cut(s) 24
BstMBI GATC 1 cut(s) 21
BstNI CCWGG 1 cut(s) 186
BstSCI CCNGG 1 cut(s) 184
BstUI CGCG 1 cut(s) 61
BtsCI GGATG 1 cut(s) 61
Cac8I GCNNGC 1 cut(s) 197
CaiI CAGNNNCTG 1 cut(s) 205
CfoI GCGC 1 cut(s) 61
Cfr13I GGNCC 1 cut(s) 202
CseI GACGC 1 cut(s) 98
Csp6I GTAC 1 cut(s) 121
CviJI RGCY 1 cut(s) 189
CviKI_1 RGCY 1 cut(s) 189
CviQI GTAC 1 cut(s) 121
DpnI GATC 1 cut(s) 23
DpnII GATC 1 cut(s) 21
Eam1104I CTCTTC 1 cut(s) 183
EarI CTCTTC 1 cut(s) 183
Eco47I GGWCC 1 cut(s) 202
EcoO109I RGGNCCY 1 cut(s) 202
EcoRII CCWGG 1 cut(s) 184
FokI GGATG 1 cut(s) 68
GlaI GCGC 1 cut(s) 60
GsuI CTGGAG 1 cut(s) 168
HgaI GACGC 1 cut(s) 98
HhaI GCGC 1 cut(s) 61
Hin6I GCGC 1 cut(s) 59
HinP1I GCGC 1 cut(s) 59
HinfI GANTC 1 cut(s) 146
Hpy188I TCNGA 1 cut(s) 151
Hpy188III TCNNGA 2 cut(s) 17, 76
HpyAV CCTTC 4 cut(s) 42, 46, 79, 148
HpyCH4V TGCA 2 cut(s) 44, 199
HspAI GCGC 1 cut(s) 59
Kzo9I GATC 1 cut(s) 21
LpnPI CCDG 3 cut(s) 171, 185, 198
LweI GCATC 1 cut(s) 46
MalI GATC 1 cut(s) 23
MboI GATC 1 cut(s) 21
MboII GAAGA 1 cut(s) 170
MhlI GDGCHC 1 cut(s) 116
MluCI AATT 1 cut(s) 12
MnlI CCTC 3 cut(s) 44, 134, 192
MspR9I CCNGG 1 cut(s) 186
MvaI CCWGG 1 cut(s) 186
MvnI CGCG 1 cut(s) 61
NdeII GATC 1 cut(s) 21
PfeI GAWTC 1 cut(s) 146
PpuMI RGGWCCY 1 cut(s) 202
Psp5II RGGWCCY 1 cut(s) 202
Psp6I CCWGG 1 cut(s) 184
PspGI CCWGG 1 cut(s) 184
PspPI GGNCC 1 cut(s) 202
PspPPI RGGWCCY 1 cut(s) 202
PstNI CAGNNNCTG 1 cut(s) 205
RsaI GTAC 1 cut(s) 122
RsaNI GTAC 1 cut(s) 121
Sau3AI GATC 1 cut(s) 21
Sau96I GGNCC 1 cut(s) 202
ScrFI CCNGG 1 cut(s) 186
SduI GDGCHC 1 cut(s) 116
SetI ASST 3 cut(s) 108, 126, 207
SfaNI GCATC 1 cut(s) 46
SinI GGWCC 1 cut(s) 202
SmlI CTYRAG 1 cut(s) 190
SmoI CTYRAG 1 cut(s) 190
Sse9I AATT 1 cut(s) 12
StyD4I CCNGG 1 cut(s) 184
TasI AATT 1 cut(s) 12
TfiI GAWTC 1 cut(s) 146
VpaK11BI GGWCC 1 cut(s) 202
XapI RAATTY 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.